itsxpress - not fastq.gz format error

version used:

qiime2-2022.2
q2-itsxpress 1.8.0 pypi_0 pypi
itsxpress 1.8.0 pyhdfd78af_2 bioconda
bbmap 38.98 h5c4e2a8_1 bioconda

I was trying to run this command:

      qiime itsxpress trim-pair-output-unmerged  
      --i-per-sample-sequences paired-end-demux.qza   
      --p-region ITS2   
      --p-taxa F   
      --p-threads 4   
      --o-trimmed trimmed.qza

After an hour or so of running the command, I got the following error:

  Plugin error from itsxpress:
    
      /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-y7x6o929/F23_38_L001_R1_001.fastq.gz is not a(n) FastqGzFormat file:
    
      Missing sequence for record beginning on line 9
    
    Debug info has been saved to /tmp/qiime2-q2cli-err-jovciu4z.log

Below is what is at the end of the log file

Traceback (most recent call last):
  File "/home/ubuntu/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/qiime2/plugin/model/file_format.py", line 26, in validate
    self._validate_(level)
  File "/home/ubuntu/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/q2_types/per_sample_sequences/_format.py", line 284, in _validate_
    self._check_n_records(record_count_map[level])
  File "/home/ubuntu/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/q2_types/per_sample_sequences/_format.py", line 253, in _check_n_records
    raise ValidationError('Missing sequence for record '
qiime2.core.exceptions.ValidationError: Missing sequence for record beginning on line 9

The above exception was the direct cause of the following exception:

Traceback (most recent call last):
  File "/home/ubuntu/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/q2cli/commands.py", line 339, in __call__
    results = action(**arguments)
  File "<decorator-gen-461>", line 2, in trim_pair_output_unmerged
  File "/home/ubuntu/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/qiime2/sdk/action.py", line 245, in bound_callable
    outputs = self._callable_executor_(scope, callable_args,
  File "/home/ubuntu/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/qiime2/sdk/action.py", line 418, in _callable_executor_
    artifact = qiime2.sdk.Artifact._from_view(
  File "/home/ubuntu/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/qiime2/sdk/result.py", line 305, in _from_view
    result = transformation(view, validate_level)
  File "/home/ubuntu/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/qiime2/core/transform.py", line 68, in transformation
    self.validate(view, level=validate_level)
  File "/home/ubuntu/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/qiime2/core/transform.py", line 143, in validate
    view.validate(level)
  File "/home/ubuntu/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/qiime2/plugin/model/directory_format.py", line 173, in validate
    getattr(self, field)._validate_members(collected_paths, level)
  File "/home/ubuntu/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/qiime2/plugin/model/directory_format.py", line 103, in _validate_members
    self.format(path, mode='r').validate(level)
  File "/home/ubuntu/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/qiime2/plugin/model/file_format.py", line 28, in validate
    raise ValidationError(
qiime2.core.exceptions.ValidationError: /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-y7x6o929/F23_38_L001_R1_001.fastq.gz is not a(n) FastqGzFormat file:

Missing sequence for record beginning on line 9

``

The log file attached as well.

I checked the sequencing file for the error on line 9, but it looks OK to me!

Any help to navigate through this error is highly appreciated!

Thanks in advance.

Aseeri

1 Like

@AAN_Aseeri,
Could you post your importing commands as well?

Thank you for your reply @Keegan-Evans.

Here it is:

qiime tools import \
  --type 'SampleData[PairedEndSequencesWithQuality]' \
  --input-path pe-33-manifest.txt \
  --output-path paired-end-demux.qza \
  --input-format PairedEndFastqManifestPhred33V2

@AAN_Aseeri,

Ok after looking into this a bit more, it appears to be coming from an old bug in itsexpress. Check out this post and see if it helps, if not let me know and we will get it figured out.

Hi @Keegan-Evans

Thank you for your reply,

I have done what is suggested in the recommended post, and yet, I am still getting the same error.

Plugin error from itsxpress:
    
      /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-y7x6o929/F23_38_L001_R1_001.fastq.gz is not a(n) FastqGzFormat file:
    
      Missing sequence for record beginning on line 9

After checking the sequence file, it looks OK to me! no errors!

(base) [email protected]:~/ITS2/sequences_copy$ gzip -dc F23_1.fq.gz | head -n 10
@A00783:953:HMLKWDRXY:2:2101:25039:1204 1:N:0:TACGACGT+CCATGAAC
TACAAG
+
FFFFFF
@A00783:953:HMLKWDRXY:2:2101:31168:1266 1:N:0:TACGACGT+CCATGAAC
ATATCAATAAGCGGAGGACGTACGTCAAGTGCATCGATGAAGAACGCA
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@A00783:953:HMLKWDRXY:2:2101:21178:1376 1:N:0:TACGACGT+CCATGAAC
AGCAGTGCACCGATGAAGAACGCAGCAGCAGTGCATCGATGAAGAACGCA

Any help or guidance is highly appreciated!

Regards,
Aseeri

@AAN_Aseeri,

Could you trying manually removing that entire entry, re importing, and running the command again with the --verbose flag?

Hi @Keegan-Evans,

I did re-import and run the trimming command. Still getting the same error!

Thanks in advance for the help,

Aseeri

Alright @AAN_Aseeri , can you post the output of qiime info and conda list of your activated environment here?

Hi @Keegan-Evans ,

Indeed, here they are;

(qiime2-2022.8) [email protected]:~$ qiime info
System versions
Python version: 3.8.13
QIIME 2 release: 2022.8
QIIME 2 version: 2022.8.1
q2cli version: 2022.8.0

Installed plugins
alignment: 2022.8.0
composition: 2022.8.0
cutadapt: 2022.8.0
dada2: 2022.8.0
deblur: 2022.8.0
demux: 2022.8.0
diversity: 2022.8.0
diversity-lib: 2022.8.0
emperor: 2022.8.0
feature-classifier: 2022.8.0
feature-table: 2022.8.0
fragment-insertion: 2022.8.0
gneiss: 2022.8.0
itsxpress: 1.8.0
longitudinal: 2022.8.0
metadata: 2022.8.0
phylogeny: 2022.8.0
quality-control: 2022.8.0
quality-filter: 2022.8.0
sample-classifier: 2022.8.0
taxa: 2022.8.0
types: 2022.8.0
vsearch: 2022.8.0

Application config directory
/home/ubuntu/miniconda3/envs/qiime2-2022.8/var/q2cli

Getting help
To get help with QIIME 2, visit https://qiime2.org
(qiime2-2022.8) [email protected]:~$

(qiime2-2022.8) [email protected]:~$ conda list
# packages in environment at /home/ubuntu/miniconda3/envs/qiime2-2022.8:
#
# Name                    Version                   Build  Channel
_libgcc_mutex             0.1                 conda_forge    conda-forge
_openmp_mutex             4.5                       2_gnu    conda-forge
_r-mutex                  1.0.1               anacondar_1    conda-forge
alsa-lib                  1.2.6.1              h7f98852_0    conda-forge
argcomplete               2.0.0              pyhd8ed1ab_0    conda-forge
asttokens                 2.0.8              pyhd8ed1ab_0    conda-forge
atpublic                  3.0.1              pyhd8ed1ab_0    conda-forge
attr                      2.5.1                h166bdaf_1    conda-forge
attrs                     22.1.0             pyh71513ae_1    conda-forge
backcall                  0.2.0              pyh9f0ad1d_0    conda-forge
backports                 1.0                        py_2    conda-forge
backports.functools_lru_cache 1.6.4              pyhd8ed1ab_0    conda-forge
bbmap                     38.99                h5c4e2a8_0    bioconda
bibtexparser              1.3.0              pyhd8ed1ab_0    conda-forge
binutils_impl_linux-64    2.36.1               h193b22a_2    conda-forge
bioconductor-biobase      2.54.0            r41h5c21468_1    bioconda
bioconductor-biocgenerics 0.40.0            r41hdfd78af_0    bioconda
bioconductor-biocparallel 1.28.3            r41h619a076_0    bioconda
bioconductor-biostrings   2.62.0            r41h5c21468_1    bioconda
bioconductor-dada2        1.22.0            r41h619a076_1    bioconda
bioconductor-delayedarray 0.20.0            r41h5c21468_1    bioconda
bioconductor-genomeinfodb 1.30.0            r41hdfd78af_0    bioconda
bioconductor-genomeinfodbdata 1.2.7             r41hdfd78af_2    bioconda
bioconductor-genomicalignments 1.30.0            r41h5c21468_1    bioconda
bioconductor-genomicranges 1.46.1            r41h5c21468_0    bioconda
bioconductor-iranges      2.28.0            r41h5c21468_1    bioconda
bioconductor-matrixgenerics 1.6.0             r41hdfd78af_0    bioconda
bioconductor-rhtslib      1.26.0            r41h5c21468_1    bioconda
bioconductor-rsamtools    2.10.0            r41h619a076_1    bioconda
bioconductor-s4vectors    0.32.3            r41h5c21468_0    bioconda
bioconductor-shortread    1.52.0            r41h619a076_1    bioconda
bioconductor-summarizedexperiment 1.24.0            r41hdfd78af_0    bioconda
bioconductor-xvector      0.34.0            r41h5c21468_1    bioconda
bioconductor-zlibbioc     1.40.0            r41h5c21468_1    bioconda
biom-format               2.1.12           py38h71d37f0_1    conda-forge
biopython                 1.79             py38h0a891b7_2    conda-forge
blast                     2.13.0               hf3cf87c_0    bioconda
bokeh                     2.4.3              pyhd8ed1ab_3    conda-forge
bowtie2                   2.4.5            py38hfbc8389_3    bioconda
brotli                    1.0.9                h166bdaf_7    conda-forge
brotli-bin                1.0.9                h166bdaf_7    conda-forge
brotlipy                  0.7.0           py38h0a891b7_1004    conda-forge
bwidget                   1.9.14               ha770c72_1    conda-forge
bzip2                     1.0.8                h7f98852_4    conda-forge
c-ares                    1.18.1               h7f98852_0    conda-forge
ca-certificates           2022.9.14            ha878542_0    conda-forge
cachecontrol              0.12.11            pyhd8ed1ab_0    conda-forge
cairo                     1.16.0            ha61ee94_1012    conda-forge
certifi                   2022.9.14          pyhd8ed1ab_0    conda-forge
cffi                      1.15.1           py38h4a40e3a_0    conda-forge
charset-normalizer        2.1.1              pyhd8ed1ab_0    conda-forge
click                     8.1.3            py38h578d9bd_0    conda-forge
colorama                  0.4.5              pyhd8ed1ab_0    conda-forge
cryptography              37.0.4           py38h2b5fc30_0    conda-forge
curl                      7.83.1               h7bff187_0    conda-forge
cutadapt                  4.1              py38hbff2b2d_1    bioconda
cycler                    0.11.0             pyhd8ed1ab_0    conda-forge
cython                    0.29.32          py38hfa26641_0    conda-forge
dbus                      1.13.6               h5008d03_3    conda-forge
deblur                    1.1.1              pyhdfd78af_0    bioconda
debugpy                   1.6.3            py38hfa26641_0    conda-forge
decorator                 4.4.2                      py_0    conda-forge
dendropy                  4.5.2              pyh3252c3a_0    bioconda
dill                      0.3.5.1            pyhd8ed1ab_0    conda-forge
dnaio                     0.9.1            py38hbff2b2d_1    bioconda
emperor                   1.0.3            py38h578d9bd_0    conda-forge
entrez-direct             16.2                 he881be0_1    bioconda
entrypoints               0.4                pyhd8ed1ab_0    conda-forge
executing                 0.10.0             pyhd8ed1ab_0    conda-forge
expat                     2.4.8                h27087fc_0    conda-forge
fastcluster               1.2.6            py38h47df419_1    conda-forge
fasttree                  2.1.11               hec16e2b_1    bioconda
fftw                      3.3.10          nompi_ha7695d1_103    conda-forge
flufl.lock                7.0                pyhd8ed1ab_0    conda-forge
font-ttf-dejavu-sans-mono 2.37                 hab24e00_0    conda-forge
font-ttf-inconsolata      3.000                h77eed37_0    conda-forge
font-ttf-source-code-pro  2.038                h77eed37_0    conda-forge
font-ttf-ubuntu           0.83                 hab24e00_0    conda-forge
fontconfig                2.14.0               h8e229c2_0    conda-forge
fonts-conda-ecosystem     1                             0    conda-forge
fonts-conda-forge         1                             0    conda-forge
fonttools                 4.37.1           py38h0a891b7_0    conda-forge
freetype                  2.12.1               hca18f0e_0    conda-forge
fribidi                   1.0.10               h36c2ea0_0    conda-forge
future                    0.18.2           py38h578d9bd_5    conda-forge
gcc_impl_linux-64         12.1.0              hea43390_16    conda-forge
gettext                   0.19.8.1          h73d1719_1008    conda-forge
gfortran_impl_linux-64    12.1.0              h1db8e46_16    conda-forge
giflib                    5.2.1                h36c2ea0_2    conda-forge
glib                      2.72.1               h6239696_0    conda-forge
glib-tools                2.72.1               h6239696_0    conda-forge
gneiss                    0.4.6                      py_0    bioconda
graphite2                 1.3.13            h58526e2_1001    conda-forge
gsl                       2.7                  he838d99_0    conda-forge
gst-plugins-base          1.20.3               hf6a322e_0    conda-forge
gstreamer                 1.20.3               hd4edc92_0    conda-forge
gxx_impl_linux-64         12.1.0              hea43390_16    conda-forge
h5py                      2.10.0          nompi_py38h9915d05_106    conda-forge
harfbuzz                  5.1.0                hf9f4e7c_0    conda-forge
hdf5                      1.10.6          nompi_h6a2412b_1114    conda-forge
hdmedians                 0.14.2           py38h71d37f0_2    conda-forge
hmmer                     3.1b2                         3    bioconda
htslib                    1.15.1               h9753748_0    bioconda
icu                       70.1                 h27087fc_0    conda-forge
idna                      3.3                pyhd8ed1ab_0    conda-forge
ijson                     3.1.3              pyhd3deb0d_0    conda-forge
importlib-metadata        4.11.4           py38h578d9bd_0    conda-forge
importlib_metadata        4.11.4               hd8ed1ab_0    conda-forge
importlib_resources       5.9.0              pyhd8ed1ab_0    conda-forge
iniconfig                 1.1.1              pyh9f0ad1d_0    conda-forge
iow                       1.0.5            py38h8ded8fe_1    bioconda
ipykernel                 6.15.1             pyh210e3f2_0    conda-forge
ipython                   8.4.0              pyh41d4057_1    conda-forge
ipython_genutils          0.2.0                      py_1    conda-forge
ipywidgets                8.0.1              pyhd8ed1ab_0    conda-forge
iqtree                    2.2.0.3              hb97b32f_1    bioconda
isa-l                     2.30.0               ha770c72_4    conda-forge
itsxpress                 1.8.0                      py_1    bioconda
jack                      1.9.18            h8c3723f_1002    conda-forge
jedi                      0.18.1             pyhd8ed1ab_2    conda-forge
jinja2                    3.1.2              pyhd8ed1ab_1    conda-forge
joblib                    1.1.0              pyhd8ed1ab_0    conda-forge
jpeg                      9e                   h166bdaf_2    conda-forge
jq                        1.6               h36c2ea0_1000    conda-forge
jsonschema                4.14.0             pyhd8ed1ab_0    conda-forge
jupyter_client            7.3.4              pyhd8ed1ab_0    conda-forge
jupyter_core              4.11.1           py38h578d9bd_0    conda-forge
jupyterlab_widgets        3.0.2              pyhd8ed1ab_0    conda-forge
kernel-headers_linux-64   2.6.32              he073ed8_15    conda-forge
keyutils                  1.6.1                h166bdaf_0    conda-forge
kiwisolver                1.4.4            py38h43d8883_0    conda-forge
krb5                      1.19.3               h3790be6_0    conda-forge
lcms2                     2.12                 hddcbb42_0    conda-forge
ld_impl_linux-64          2.36.1               hea4e1c9_2    conda-forge
lerc                      3.0                  h9c3ff4c_0    conda-forge
libblas                   3.9.0           16_linux64_openblas    conda-forge
libbrotlicommon           1.0.9                h166bdaf_7    conda-forge
libbrotlidec              1.0.9                h166bdaf_7    conda-forge
libbrotlienc              1.0.9                h166bdaf_7    conda-forge
libcap                    2.64                 ha37c62d_0    conda-forge
libcblas                  3.9.0           16_linux64_openblas    conda-forge
libclang                  14.0.6          default_h2e3cab8_0    conda-forge
libclang13                14.0.6          default_h3a83d3e_0    conda-forge
libcups                   2.3.3                h3e49a29_2    conda-forge
libcurl                   7.83.1               h7bff187_0    conda-forge
libdb                     6.2.32               h9c3ff4c_0    conda-forge
libdeflate                1.10                 h7f98852_0    conda-forge
libedit                   3.1.20191231         he28a2e2_2    conda-forge
libev                     4.33                 h516909a_1    conda-forge
libevent                  2.1.10               h9b69904_4    conda-forge
libffi                    3.4.2                h7f98852_5    conda-forge
libflac                   1.3.4                h27087fc_0    conda-forge
libgcc-devel_linux-64     12.1.0              h1ec3361_16    conda-forge
libgcc-ng                 12.1.0              h8d9b700_16    conda-forge
libgfortran-ng            12.1.0              h69a702a_16    conda-forge
libgfortran5              12.1.0              hdcd56e2_16    conda-forge
libglib                   2.72.1               h2d90d5f_0    conda-forge
libgomp                   12.1.0              h8d9b700_16    conda-forge
libiconv                  1.16                 h516909a_0    conda-forge
libidn2                   2.3.3                h166bdaf_0    conda-forge
liblapack                 3.9.0           16_linux64_openblas    conda-forge
liblapacke                3.9.0           16_linux64_openblas    conda-forge
libllvm10                 10.0.1               he513fc3_3    conda-forge
libllvm14                 14.0.6               he0ac6c6_0    conda-forge
libnghttp2                1.47.0               hdcd2b5c_1    conda-forge
libnsl                    2.0.0                h7f98852_0    conda-forge
libogg                    1.3.4                h7f98852_1    conda-forge
libopenblas               0.3.21          pthreads_h78a6416_2    conda-forge
libopus                   1.3.1                h7f98852_1    conda-forge
libpng                    1.6.37               h753d276_4    conda-forge
libpq                     14.5                 hd77ab85_0    conda-forge
libsanitizer              12.1.0              ha89aaad_16    conda-forge
libsndfile                1.0.31               h9c3ff4c_1    conda-forge
libsodium                 1.0.18               h36c2ea0_1    conda-forge
libsqlite                 3.39.2               h753d276_1    conda-forge
libssh2                   1.10.0               haa6b8db_3    conda-forge
libstdcxx-devel_linux-64  12.1.0              h1ec3361_16    conda-forge
libstdcxx-ng              12.1.0              ha89aaad_16    conda-forge
libtiff                   4.4.0                h0fcbabc_0    conda-forge
libtool                   2.4.6             h9c3ff4c_1008    conda-forge
libudev1                  249                  h166bdaf_4    conda-forge
libunistring              0.9.10               h7f98852_0    conda-forge
libuuid                   2.32.1            h7f98852_1000    conda-forge
libvorbis                 1.3.7                h9c3ff4c_0    conda-forge
libwebp-base              1.2.4                h166bdaf_0    conda-forge
libxcb                    1.13              h7f98852_1004    conda-forge
libxkbcommon              1.0.3                he3ba5ed_0    conda-forge
libxml2                   2.9.14               h22db469_4    conda-forge
libxslt                   1.1.35               h8affb1d_0    conda-forge
libzlib                   1.2.12               h166bdaf_2    conda-forge
llvmlite                  0.36.0           py38h4630a5e_0    conda-forge
lockfile                  0.12.2                     py_1    conda-forge
lxml                      4.9.1            py38h0a891b7_0    conda-forge
lz4                       4.0.0            py38h1bf946c_2    conda-forge
lz4-c                     1.9.3                h9c3ff4c_1    conda-forge
mafft                     7.505                hec16e2b_0    bioconda
make                      4.3                  hd18ef5c_1    conda-forge
markupsafe                2.1.1            py38h0a891b7_1    conda-forge
matplotlib                3.5.3            py38h578d9bd_2    conda-forge
matplotlib-base           3.5.3            py38h38b5ce0_2    conda-forge
matplotlib-inline         0.1.6              pyhd8ed1ab_0    conda-forge
msgpack-python            1.0.4            py38h43d8883_0    conda-forge
munkres                   1.1.4              pyh9f0ad1d_0    conda-forge
mysql-common              8.0.30               haf5c9bc_0    conda-forge
mysql-libs                8.0.30               h28c427c_0    conda-forge
natsort                   8.1.0              pyhd8ed1ab_0    conda-forge
nbformat                  5.4.0              pyhd8ed1ab_0    conda-forge
ncurses                   6.3                  h27087fc_1    conda-forge
nest-asyncio              1.5.5              pyhd8ed1ab_0    conda-forge
networkx                  2.8.6              pyhd8ed1ab_0    conda-forge
nose                      1.3.7                   py_1006    conda-forge
nspr                      4.32                 h9c3ff4c_1    conda-forge
nss                       3.78                 h2350873_0    conda-forge
numba                     0.53.1           py38h8b71fd7_1    conda-forge
numpy                     1.23.2           py38h3a7f9d9_0    conda-forge
oniguruma                 6.9.8                h166bdaf_0    conda-forge
openjdk                   17.0.3               h1e1ecb3_1    conda-forge
openjpeg                  2.5.0                h7d73246_1    conda-forge
openssl                   1.1.1q               h166bdaf_0    conda-forge
packaging                 21.3               pyhd8ed1ab_0    conda-forge
pandas                    1.4.3            py38h47df419_0    conda-forge
pango                     1.50.9               hc4f8a73_0    conda-forge
parso                     0.8.3              pyhd8ed1ab_0    conda-forge
patsy                     0.5.2              pyhd8ed1ab_0    conda-forge
pbzip2                    1.1.13                        0    conda-forge
pcre                      8.45                 h9c3ff4c_0    conda-forge
pcre2                     10.37                hc3806b6_1    conda-forge
perl                      5.32.1          2_h7f98852_perl5    conda-forge
perl-archive-tar          2.40            pl5321hdfd78af_0    bioconda
perl-carp                 1.50            pl5321hd8ed1ab_0    conda-forge
perl-common-sense         3.75            pl5321hd8ed1ab_0    conda-forge
perl-compress-raw-bzip2   2.201           pl5321h166bdaf_0    conda-forge
perl-compress-raw-zlib    2.202           pl5321h166bdaf_0    conda-forge
perl-encode               3.19            pl5321hec16e2b_1    bioconda
perl-exporter             5.74            pl5321hd8ed1ab_0    conda-forge
perl-exporter-tiny        1.002002        pl5321hd8ed1ab_0    conda-forge
perl-extutils-makemaker   7.64            pl5321hd8ed1ab_0    conda-forge
perl-io-compress          2.106           pl5321h87f3376_1    bioconda
perl-io-zlib              1.11            pl5321hdfd78af_0    bioconda
perl-json                 4.09            pl5321hdfd78af_0    bioconda
perl-json-xs              2.34            pl5321h9f5acd7_5    bioconda
perl-list-moreutils       0.430           pl5321hdfd78af_0    bioconda
perl-list-moreutils-xs    0.430           pl5321hec16e2b_1    bioconda
perl-parent               0.238           pl5321hd8ed1ab_0    conda-forge
perl-pathtools            3.75            pl5321h166bdaf_0    conda-forge
perl-scalar-list-utils    1.63            pl5321h166bdaf_0    conda-forge
perl-types-serialiser     1.01            pl5321hdfd78af_0    bioconda
pexpect                   4.8.0              pyh9f0ad1d_2    conda-forge
pickleshare               0.7.5                   py_1003    conda-forge
pigz                      2.6                  h27826a3_0    conda-forge
pillow                    9.2.0            py38ha3b2c9c_2    conda-forge
pip                       22.2.2             pyhd8ed1ab_0    conda-forge
pixman                    0.40.0               h36c2ea0_0    conda-forge
pkgutil-resolve-name      1.3.10             pyhd8ed1ab_0    conda-forge
pluggy                    1.0.0            py38h578d9bd_3    conda-forge
ply                       3.11                       py_1    conda-forge
portaudio                 19.6.0               h57a0ea0_5    conda-forge
prompt-toolkit            3.0.30             pyha770c72_0    conda-forge
psutil                    5.9.1            py38h0a891b7_0    conda-forge
pthread-stubs             0.4               h36c2ea0_1001    conda-forge
ptyprocess                0.7.0              pyhd3deb0d_0    conda-forge
pulseaudio                14.0                 h7f54b18_8    conda-forge
pure_eval                 0.2.2              pyhd8ed1ab_0    conda-forge
py                        1.11.0             pyh6c4a22f_0    conda-forge
pycparser                 2.21               pyhd8ed1ab_0    conda-forge
pygments                  2.13.0             pyhd8ed1ab_0    conda-forge
pynndescent               0.5.7              pyh6c4a22f_0    conda-forge
pyopenssl                 22.0.0             pyhd8ed1ab_0    conda-forge
pyparsing                 3.0.9              pyhd8ed1ab_0    conda-forge
pyqt                      5.15.7           py38h7492b6b_0    conda-forge
pyqt5-sip                 12.11.0          py38hfa26641_0    conda-forge
pyrsistent                0.18.1           py38h0a891b7_1    conda-forge
pysocks                   1.7.1            py38h578d9bd_5    conda-forge
pytest                    7.1.2            py38h578d9bd_0    conda-forge
python                    3.8.13          h582c2e5_0_cpython    conda-forge
python-dateutil           2.8.2              pyhd8ed1ab_0    conda-forge
python-fastjsonschema     2.16.1             pyhd8ed1ab_0    conda-forge
python-isal               1.0.1            py38h0a891b7_0    conda-forge
python_abi                3.8                      2_cp38    conda-forge
pytz                      2022.2.1           pyhd8ed1ab_0    conda-forge
pyyaml                    6.0              py38h0a891b7_4    conda-forge
pyzmq                     23.2.1           py38hfc09fa9_0    conda-forge
q2-alignment              2022.8.0                 py38_0    qiime2/label/r2022.8
q2-composition            2022.8.0                 py38_0    qiime2/label/r2022.8
q2-cutadapt               2022.8.0                 py38_0    qiime2/label/r2022.8
q2-dada2                  2022.8.0                 py38_0    qiime2/label/r2022.8
q2-deblur                 2022.8.0                 py38_0    qiime2/label/r2022.8
q2-demux                  2022.8.0                 py38_0    qiime2/label/r2022.8
q2-diversity              2022.8.0                 py38_0    qiime2/label/r2022.8
q2-diversity-lib          2022.8.0                 py38_0    qiime2/label/r2022.8
q2-emperor                2022.8.0                 py38_0    qiime2/label/r2022.8
q2-feature-classifier     2022.8.0                 py38_0    qiime2/label/r2022.8
q2-feature-table          2022.8.0                 py38_0    qiime2/label/r2022.8
q2-fragment-insertion     2022.8.0                 py38_0    qiime2/label/r2022.8
q2-gneiss                 2022.8.0                 py38_0    qiime2/label/r2022.8
q2-itsxpress              1.8.0                    pypi_0    pypi
q2-longitudinal           2022.8.0                 py38_0    qiime2/label/r2022.8
q2-metadata               2022.8.0                 py38_0    qiime2/label/r2022.8
q2-mystery-stew           2022.8.0                 py38_0    qiime2/label/r2022.8
q2-phylogeny              2022.8.0                 py38_0    qiime2/label/r2022.8
q2-quality-control        2022.8.0                 py38_0    qiime2/label/r2022.8
q2-quality-filter         2022.8.0                 py38_0    qiime2/label/r2022.8
q2-sample-classifier      2022.8.0                 py38_0    qiime2/label/r2022.8
q2-taxa                   2022.8.0                 py38_0    qiime2/label/r2022.8
q2-types                  2022.8.0                 py38_0    qiime2/label/r2022.8
q2-vsearch                2022.8.0                 py38_0    qiime2/label/r2022.8
q2cli                     2022.8.0                 py38_0    qiime2/label/r2022.8
q2galaxy                  2022.8.1                 py38_0    qiime2/label/r2022.8
q2templates               2022.8.0                 py38_0    qiime2/label/r2022.8
qiime2                    2022.8.1                 py38_0    qiime2/label/r2022.8
qt-main                   5.15.4               ha5833f6_2    conda-forge
r-backports               1.4.1             r41hcfec24a_0    conda-forge
r-base                    4.1.3                ha8c3e7c_2    conda-forge
r-bh                      1.78.0_0          r41hc72bb7e_0    conda-forge
r-bitops                  1.0_7             r41h06615bd_0    conda-forge
r-brio                    1.1.3             r41hcfec24a_0    conda-forge
r-callr                   3.7.2             r41hc72bb7e_0    conda-forge
r-cli                     3.3.0             r41h7525677_0    conda-forge
r-cluster                 2.1.3             r41h8da6f51_0    conda-forge
r-colorspace              2.0_3             r41h06615bd_0    conda-forge
r-crayon                  1.5.1             r41hc72bb7e_0    conda-forge
r-deldir                  1.0_6             r41h8da6f51_0    conda-forge
r-desc                    1.4.1             r41hc72bb7e_0    conda-forge
r-diffobj                 0.3.5             r41hcfec24a_0    conda-forge
r-digest                  0.6.29            r41h03ef668_0    conda-forge
r-ellipsis                0.3.2             r41hcfec24a_0    conda-forge
r-evaluate                0.16              r41hc72bb7e_0    conda-forge
r-fansi                   1.0.3             r41h06615bd_0    conda-forge
r-farver                  2.1.1             r41h7525677_0    conda-forge
r-formatr                 1.12              r41hc72bb7e_0    conda-forge
r-fs                      1.5.2             r41h7525677_1    conda-forge
r-futile.logger           1.4.3           r41hc72bb7e_1003    conda-forge
r-futile.options          1.0.1           r41hc72bb7e_1002    conda-forge
r-getopt                  1.20.3            r41ha770c72_2    conda-forge
r-ggplot2                 3.3.6             r41hc72bb7e_0    conda-forge
r-glue                    1.6.2             r41h06615bd_0    conda-forge
r-gtable                  0.3.0             r41hc72bb7e_3    conda-forge
r-hwriter                 1.3.2.1           r41hc72bb7e_0    conda-forge
r-interp                  1.1_3             r41h7525677_0    conda-forge
r-isoband                 0.2.5             r41h03ef668_0    conda-forge
r-jpeg                    0.1_9             r41hcfec24a_0    conda-forge
r-jsonlite                1.8.0             r41h06615bd_0    conda-forge
r-labeling                0.4.2             r41hc72bb7e_1    conda-forge
r-lambda.r                1.2.4             r41hc72bb7e_1    conda-forge
r-lattice                 0.20_45           r41hcfec24a_0    conda-forge
r-latticeextra            0.6_30            r41hc72bb7e_0    conda-forge
r-lifecycle               1.0.1             r41hc72bb7e_0    conda-forge
r-magrittr                2.0.3             r41h06615bd_0    conda-forge
r-mass                    7.3_58.1          r41h06615bd_0    conda-forge
r-matrix                  1.4_1             r41h0154571_0    conda-forge
r-matrixstats             0.62.0            r41h06615bd_0    conda-forge
r-mgcv                    1.8_40            r41h0154571_0    conda-forge
r-munsell                 0.5.0           r41hc72bb7e_1004    conda-forge
r-nlme                    3.1_159           r41h8da6f51_0    conda-forge
r-optparse                1.7.3             r41hc72bb7e_0    conda-forge
r-permute                 0.9_7             r41hc72bb7e_0    conda-forge
r-pillar                  1.8.1             r41hc72bb7e_0    conda-forge
r-pkgconfig               2.0.3             r41hc72bb7e_1    conda-forge
r-pkgload                 1.3.0             r41hc72bb7e_0    conda-forge
r-plyr                    1.8.7             r41h7525677_0    conda-forge
r-png                     0.1_7           r41hcfec24a_1004    conda-forge
r-praise                  1.0.0           r41hc72bb7e_1005    conda-forge
r-processx                3.7.0             r41h06615bd_0    conda-forge
r-ps                      1.7.1             r41h06615bd_0    conda-forge
r-r6                      2.5.1             r41hc72bb7e_0    conda-forge
r-rcolorbrewer            1.1_3             r41h785f33e_0    conda-forge
r-rcpp                    1.0.9             r41h7525677_1    conda-forge
r-rcppeigen               0.3.3.9.2         r41h43535f1_0    conda-forge
r-rcppparallel            5.1.5             r41h7525677_0    conda-forge
r-rcurl                   1.98_1.8          r41h06615bd_0    conda-forge
r-rematch2                2.1.2             r41hc72bb7e_1    conda-forge
r-reshape2                1.4.4             r41h03ef668_1    conda-forge
r-rlang                   1.0.4             r41h7525677_0    conda-forge
r-rprojroot               2.0.3             r41hc72bb7e_0    conda-forge
r-scales                  1.2.1             r41hc72bb7e_0    conda-forge
r-snow                    0.4_4             r41hc72bb7e_0    conda-forge
r-stringi                 1.7.8             r41h30a9eb7_0    conda-forge
r-stringr                 1.4.1             r41hc72bb7e_0    conda-forge
r-testthat                3.1.4             r41h7525677_0    conda-forge
r-tibble                  3.1.8             r41h06615bd_0    conda-forge
r-utf8                    1.2.2             r41hcfec24a_0    conda-forge
r-vctrs                   0.4.1             r41h7525677_0    conda-forge
r-vegan                   2.6_2             r41he5c027b_0    conda-forge
r-viridislite             0.4.1             r41hc72bb7e_0    conda-forge
r-waldo                   0.4.0             r41hc72bb7e_0    conda-forge
r-withr                   2.5.0             r41hc72bb7e_0    conda-forge
raxml                     8.2.12               hec16e2b_4    bioconda
readline                  8.1.2                h0f457ee_0    conda-forge
requests                  2.28.1             pyhd8ed1ab_0    conda-forge
samtools                  1.15.1               h1170115_0    bioconda
scikit-bio                0.5.7            py38h6c62de6_0    conda-forge
scikit-learn              0.24.1           py38h658cfdd_0    conda-forge
scipy                     1.8.1            py38hea3f02b_2    conda-forge
seaborn                   0.11.2               hd8ed1ab_0    conda-forge
seaborn-base              0.11.2             pyhd8ed1ab_0    conda-forge
sed                       4.8                  he412f7d_0    conda-forge
sepp                      4.3.10           py38h3252c3a_2    bioconda
setuptools                65.3.0             pyhd8ed1ab_1    conda-forge
sip                       6.6.2            py38hfa26641_0    conda-forge
six                       1.16.0             pyh6c4a22f_0    conda-forge
sortmerna                 2.0                  he860b03_4    bioconda
sqlite                    3.39.2               h4ff8645_1    conda-forge
stack_data                0.4.0              pyhd8ed1ab_0    conda-forge
statsmodels               0.13.2           py38h71d37f0_0    conda-forge
sysroot_linux-64          2.12                he073ed8_15    conda-forge
tbb                       2020.2               h4bd325d_4    conda-forge
threadpoolctl             3.1.0              pyh8a188c0_0    conda-forge
tk                        8.6.12               h27826a3_0    conda-forge
tktable                   2.10                 hb7b940f_3    conda-forge
toml                      0.10.2             pyhd8ed1ab_0    conda-forge
tomli                     2.0.1              pyhd8ed1ab_0    conda-forge
tornado                   6.2              py38h0a891b7_0    conda-forge
tqdm                      4.64.0             pyhd8ed1ab_0    conda-forge
traitlets                 5.3.0              pyhd8ed1ab_0    conda-forge
typing_extensions         4.3.0              pyha770c72_0    conda-forge
tzlocal                   2.1                pyh9f0ad1d_0    conda-forge
umap-learn                0.5.3            py38h578d9bd_0    conda-forge
unicodedata2              14.0.0           py38h0a891b7_1    conda-forge
unifrac                   1.1.1            py38h17adfb0_1    bioconda
unifrac-binaries          1.1.1                h15a0faf_1    bioconda
urllib3                   1.26.11            pyhd8ed1ab_0    conda-forge
vsearch                   2.21.1               hf1761c0_1    bioconda
wcwidth                   0.2.5              pyh9f0ad1d_2    conda-forge
wget                      1.20.3               ha56f1ee_1    conda-forge
wheel                     0.37.1             pyhd8ed1ab_0    conda-forge
widgetsnbextension        4.0.2              pyhd8ed1ab_0    conda-forge
xcb-util                  0.4.0                h166bdaf_0    conda-forge
xcb-util-image            0.4.0                h166bdaf_0    conda-forge
xcb-util-keysyms          0.4.0                h166bdaf_0    conda-forge
xcb-util-renderutil       0.3.9                h166bdaf_0    conda-forge
xcb-util-wm               0.4.1                h166bdaf_0    conda-forge
xmltodict                 0.13.0             pyhd8ed1ab_0    conda-forge
xopen                     1.6.0            py38h578d9bd_0    conda-forge
xorg-fixesproto           5.0               h7f98852_1002    conda-forge
xorg-inputproto           2.3.2             h7f98852_1002    conda-forge
xorg-kbproto              1.0.7             h7f98852_1002    conda-forge
xorg-libice               1.0.10               h7f98852_0    conda-forge
xorg-libsm                1.2.3             hd9c2040_1000    conda-forge
xorg-libx11               1.7.2                h7f98852_0    conda-forge
xorg-libxau               1.0.9                h7f98852_0    conda-forge
xorg-libxdmcp             1.1.3                h7f98852_0    conda-forge
xorg-libxext              1.3.4                h7f98852_1    conda-forge
xorg-libxfixes            5.0.3             h7f98852_1004    conda-forge
xorg-libxi                1.7.10               h7f98852_0    conda-forge
xorg-libxrender           0.9.10            h7f98852_1003    conda-forge
xorg-libxt                1.2.1                h7f98852_2    conda-forge
xorg-libxtst              1.2.3             h7f98852_1002    conda-forge
xorg-recordproto          1.14.2            h7f98852_1002    conda-forge
xorg-renderproto          0.11.1            h7f98852_1002    conda-forge
xorg-xextproto            7.3.0             h7f98852_1002    conda-forge
xorg-xproto               7.0.31            h7f98852_1007    conda-forge
xz                        5.2.6                h166bdaf_0    conda-forge
yaml                      0.2.5                h7f98852_2    conda-forge
yq                        2.13.0             pyhd8ed1ab_0    conda-forge
zeromq                    4.3.4                h9c3ff4c_1    conda-forge
zipp                      3.8.1              pyhd8ed1ab_0    conda-forge
zlib                      1.2.12               h166bdaf_2    conda-forge
zstd                      1.5.2                h6239696_4    conda-forge
(qiime2-2022.8) [email protected]:~$

Thanks in advance for your help,

1 Like