vsearch classification error

I re imported the SILVA database exactly as instructed and re-ran the feature-classifier. Now I'm getting this error:


qiime feature-classifier classify-consensus-vsearch \

--i-query $projID-rep-seqs_NoTrunc.qza
--i-reference-reads /SILVA_db/silva13.8_1/silva-138.1-ssu-ref-seqs.qza
--i-reference-taxonomy /SILVA_db/silva13.8_1/silva-138.1-ssu-FULL-tax.qza
--p-maxaccepts 'all'
--p-threads 78
--o-classification $projID-repSeqs-SILVA13_8.1-vsearch-classified.qza
--verbose
Running external command line application. This may print messages to stdout and/or stderr.
The command being run is below. This command cannot be manually re-run as it will depend on temporary files that no longer exist.

Command: vsearch --usearch_global /tmp/qiime2-archive-pfzyq8ys/58332ddd-a506-46f4-bf18-fbf16d4729db/data/dna-sequences.fasta --id 0.8 --query_cov 0.8 --strand both --maxaccepts 0 --maxrejects 0 --db /tmp/qiime2-archive-lzir31qs/633c5659-73c0-419a-af72-16e6cdbccc19/data/dna-sequences.fasta --threads 78 --output_no_hits --blast6out /tmp/tmpr1jwos1q

vsearch v2.7.0_linux_x86_64, 377.4GB RAM, 88 cores

Reading file /tmp/qiime2-archive-lzir31qs/633c5659-73c0-419a-af72-16e6cdbccc19/data/dna-sequences.fasta 100%
3183581141 nt in 2224740 seqs, min 900, max 4000, avg 1431
Masking 100%
Counting k-mers 100%
Creating k-mer index 100%
Searching 100%
Matching query sequences: 3568 of 4383 (81.41%)
Traceback (most recent call last):
File "/home/AnalysisTools/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/q2cli/commands.py", line 339, in call
results = action(**arguments)
File "", line 2, in classify_consensus_vsearch
File "/home/AnalysisTools/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/qiime2/sdk/action.py", line 245, in bound_callable
outputs = self.callable_executor(scope, callable_args,
File "/home/AnalysisTools/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/qiime2/sdk/action.py", line 391, in callable_executor
output_views = self._callable(**view_args)
File "/home/AnalysisTools/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/q2_feature_classifier/_vsearch.py", line 62, in classify_consensus_vsearch
consensus = _consensus_assignments(
File "/home/AnalysisTools/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/q2_feature_classifier/_consensus_assignment.py", line 29, in _consensus_assignments
obs_taxa = _import_blast_format_assignments(
File "/home/AnalysisTools/miniconda3/envs/qiime2-2022.2/lib/python3.8/site-packages/q2_feature_classifier/_consensus_assignment.py", line 99, in _import_blast_format_assignments
if fields[1] == '*':
IndexError: list index out of range

Plugin error from feature-classifier:

list index out of range

See above for debug info.


We are wondering if this could be an issue with the sequence label on the query read.

Do you think you could find read number 3568 from inside projID-rep-seqs_NoTrunc.qza and post it here?

There may also be interesting clues inside of /tmp/tmpr1jwos1q if you want to post the last few lines of the vsearch temporary output file.

I think read number 3568 is:

49b7afe9a0e7db3f6a357ea0ce9b08ed
CGGTAATACATAGGGGGCGAGCGTTGTCCGGAATGACTGGGCGTAAAGGGAGTGTAGGCGGCTTGGTAAGTTATGAGTGAAAGCCCGCAGCTTAACTGCGGAACTGCTCATAAAACTGCTTGGCTTGAGTACAGGAGAGGTAAGCGGAATTCCTAGTGTAGCGGTGGAATGCGTAGATATTAGGAAGAACACCAGAGGCGAAGGCGGCTTACTGGACTGAAACTGACGCTGAGGCTCGAAAGCGTGGGGAGCAAACAGG
But I'll post 1 above and below that too just in case I mis-counted:

2530af14cac9e9a839af0c8305934509
CCGCCAGCGTTCCCACGGCTGCATTTTTCGGCGCCGCCCCGCACACCTTTTTGTATGCCGCAGGCGTCAGCCCTAATTCGCGCCAGTACGCAAGCGCGGTTTTGTTGAGCATATCCCACAGGTCGAGGTATGGGCTGCGCGTCATGTTGGTAGCCCCGGCCTTATTGGTGTGCTCCACGATGGGGCCGTCGCCGTCCTCCCGGTAGTCCGGCTGA
49b7afe9a0e7db3f6a357ea0ce9b08ed
CGGTAATACATAGGGGGCGAGCGTTGTCCGGAATGACTGGGCGTAAAGGGAGTGTAGGCGGCTTGGTAAGTTATGAGTGAAAGCCCGCAGCTTAACTGCGGAACTGCTCATAAAACTGCTTGGCTTGAGTACAGGAGAGGTAAGCGGAATTCCTAGTGTAGCGGTGGAATGCGTAGATATTAGGAAGAACACCAGAGGCGAAGGCGGCTTACTGGACTGAAACTGACGCTGAGGCTCGAAAGCGTGGGGAGCAAACAGG
ffe191c518bd9bfe712d8ab736b3b891
CGGTAATACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAAGCAAGTCAGATGTGAAAACTGTGGGCTCAACCCACAGCCTGCATTTGAAACTGTTTTTCTTGAGTACTGGAGAGGCAGATGGAATTCCTAGTGTAGCGGTGAAATGCGTAGATATTAGGAGGAACACCAGTGGCGAAGGCGATCTGCTGGACAGCAACTGACGCTGAGGCGCGAAAGCGTGGGGAGCAAACAGG


that log file /tmp/tmpr1jwos1q isn't there !

Thank you for posting that. It looks fine to me... :face_with_monocle:

_import_blast_format_assignments
if fields[1] == '*':
IndexError: list index out of range

I wonder if this is on the Qiime2 side after all.

I guess this makes sense, as it's a temp file. Liz, is there a good way to preserve temp files when running a qiime2 plugin?

Rerun that command with --verbose and post all the info it gives you so we can inspect if for clues. :female_detective: