Training classifier for ITS classification

[hongwei2017 (hongwei liu)]

Hello, Qiime team!

I have just trained my own classifier for the purpose of ITS2 sequencing analysis. However, the taxonomy results could only give me Kingdom level which is Fungi. My reads length is about 220 bp.

In this case, I doubt may be something was wrong with my choice with reads-extraction. I learnt that the average length for ITS2 region is around 340 bp, but the length for specific sequence is variable. Therefore, I ignored this part in the following command I used.

"qiime feature-classifier extract-reads --i-sequences 99_otus.qza --p-f-primer GTGARTCATCGAATCTTTG --p-r-primer TCCTCCGCTTATTGATATGC --o-reads ref-seas.qza"

Which parameter should I change to enable me to get taxonomy results in more depth? It should be abnormal to only get kingdom or phylum level.

Thanks!

[Nicholas_Bokulich]

Hi @hongwei2017,
I believe your question is a duplicate of this thread. In brief, I would not recommend using read extraction when creating an ITS classifier. ITS classification performs much better with full-length ITS sequences. That thread gives other details on choosing optimal parameters for ITS classification (see the linked preprint).

If you are still getting kingdom and phylum-level classifications with full-length sequences, please let us know as that would indeed be unusual.

Hope that helps!