Removal of Illumina Adapters

General Discussion
,
1

Hello!

I had a question about the removal of illumina adapters in some of my reads. I am quite new to Qiime and bioinformatics so any help or direction would be greatly appreciated!

I used Fastqc to check the quality of my reads, and saw that the back half of my reads are severely contaminated with Illumina Adapters. The picture below is for my forward reads, but my reverse reads share a similar story.

image
image2205×1347 182 KB

My plan is to remove these using cutadapt trim-paired with code similar to the following:
qiime cutadapt trim-paired
--i-demultiplexed-sequences Blake/16S/Demux/demultiplexed-seqs.qza
--p-anywhere-f AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
--o-trimmed-sequences Blake/16S/Demux/Adapter_Trimmed-demultiplexed-seqs.qza
--verbose

I have the Illumina Sequences saved in my metadata file so I am fairly sure they match up. My main question is regarding the reverse reads. Would I need to include a separate line with the reverse complement of the sequence I have saved?

I will likely have follow-up questions, so any advice is very helpful!

Thanks!

1 Like
2

Hello Beckett,

Welcome to the forums! :qiime2:

Here are all the settings for qiime cutadapt trim-paired.
https://docs.qiime2.org/2024.2/plugins/available/cutadapt/trim-paired/

Yes, you need to pass a *-r argument to interact with your reverse reads.

As mentioned in the docs, the --p-anywhere-* arguments could also be replaced/improved.

This option is mostly for rescuing failed library preparations - do not use if you know which end your adapter was ligated to.

Let us know what you try next! You can post related questions into this thread and someone on the team will reply.

Good luck!