Lost primers / barcodes information

Hi, my quality socre plots are:

But I lost the information of primers / barcodes for these paired sequencing.
So I don’t know how to do trim procedure.

I have some questions and need for helps:

  1. Is it any way to find the ‘unknown’ primers or barcodes?
  2. If I skip trim procedure, it is accurate if I trim the left sequencing at the denoise procedure? For example, use --p-trim-left-f = 32 and --p-trim-left-r = 9 to trim the primers.

Thanks in advance!

Hi @KE_XU,

The best way to do this is to contact the person who sequenced/processed the data, because you’ll probably want to include it in your manuscript! If it’s published, check the paper. If its your data, ask your sequencing center. (And in general, make friends with the people who sequence your data. They know all kinds of things that we can’t predict).

You could try it and see. It seems reasonable.

Best,
Justine

@jwdebelius is 100% on finding out the answer from the person who sequenced/processed the data! If for some reason you can’t, you could look at the first ~20bp on both sides and compare it against the common primer sets. Example 515F GTGCCAGCMGCCGCGGTAA and 806R GGACTACNVGGGTWTCTAAT. Here is a list of common primers you could look at:

Primer name Marker gene Target region Sequence
V1_27F 16S rRNA V1-V3 AGAGTTTGATCMTGGCTCAG
V3_534R 16S rRNA V1-V3 ATTACCGCGGCTGCTGG
V3_357F 16S rRNA V3-V4, V3-V5 CCTACGGGAGGCAGCAG
V4_515F 16S rRNA V4, V4-V6 GTGCCAGCMGCCGCGGTAA
V4_806R 16S rRNA V3-V4, V4 GGACTACHVGGGTWTCTAAT
V5F 16S rRNA V5-V6 RGGATTAGATACCC
V5_926R 16S rRNA V3-V5 CCGTCAATTCMTTTRAGT
V6R 16S rRNA V5-V6, V4-V6 CGACRRCCATGCANCACCT
18S_V9_1391_F 18S rRNA V9 GTACACACCGCCCGTC
18S_V9_EukBr_R 18S rRNA V9 TGATCCTTCTGCAGGTTCACCTAC
ITS1F ITS ITS1 CTTGGTCATTTAGAGGAAG*TAA
ITS2 ITS ITS1 GCTGCGTTCTTCATCGA*TGC
5.8SR ITS ITS2 TCGATGAAGAACGCAGCG
ITS4 ITS ITS2 TCCTCCGCTTATTGATATGC
5 Likes

Thanks for your help and provides this reference!

I have another question about checking the sequencing.
How could I generate the sequencing output from demux.qza?

Thanks in advance.

See here: Demultiplexed demux.qza to fastq files

1 Like