Training paired-end classifier

Hello, I am trying to train a classifier and am on the extract reference reads portion following the Training feature classifiers with q2-feature-classifier. I have checked that I am using the rep sequences and not the aligned sequences from 13_8 99 otus. I have attached that at the bottom. I also took out the trunc part as a recommendation on this forum How can I train classifier for Paired end reads? for paired-end reads. I am not sure where I am going wrong. I have a suspicion it might be the primers I am providing but these are the primers that were given to me by the sequencing company.

qiime feature-classifier extract-reads \

--i-sequences $Q2P/training-feature-classifiers/13_8_otus.qza
--p-f-primer TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
--p-r-primer GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG
--o-reads $Q2P/training-feature-classifiers/ref-99-trial1-seqs-trunremoved.qza
Plugin error from feature-classifier:

No matches found

Debug info has been saved to /var/folders/rn/fdps2_hj7sx4gp3x12qkf20h0000gn/T/qiime2-q2cli-err-4x4xdbgj.log

gg_13_8_otus sequences used: https://drive.google.com/file/d/1h4NTYmEn-gLO25WNCvaHzEFQ0o88U79v/view?usp=sharing

You are correct — those are not the correct primers. Looks like those are the adapter sequences. See this thread for more details. You may have different PCR primers from that user, though, so should probably check back with the sequencing center or whoever prepared the sequencing library.

Good luck!