qiime itsxpress trim-single error

I am trying to trim my Fungal ITS sequences using itsxpress.
The single end sequences are generated by a Pacbio sequel using primer ITS1F and LR3 so most of the sequences length is about 1300bp ,which contain the full ITS region plus partial 18S and 28S region .

I select two sample “S1,S2” to test this tutorial

First I import my sequences:

qiime tools import --input-format SingleEndFastqManifestPhred33V2 --type SampleData[SequencesWithQuality] --input-path manifest.txt --output-path sequences.qza

manifest.txt
sample-id absolute-filepath
S1 $PWD/Sample1.fq.gz
S2 $PWD/Sample2.fq.gz

it totally fine because I check the artifact with
qiime demux summarize

Then I trim the sequences because I want to get a full ITS region sequences without any flanking region:

qiime itsxpress trim-single --i-per-sample-sequences data/sequences.qza --p-region ALL --p-threads 12 --p-cluster-id 1.0 --o-trimmed trimmed.qza

some error happened:
Plugin error from itsxpress:

** Command ‘[‘reformat.sh’, ‘in=/tmp/qiime2-archive-s7ibswhq/0a04cfee-eab7-44cf-a88b-148c9071a7f5/data/S1_0_L001_R1_001.fastq.gz’, ‘out=/tmp/itsxpress_p3vxjmwu/seq_r1.fq.gz’, ‘out2=/tmp/itsxpress_p3vxjmwu/seq_r2.fq.gz’]’ returned non-zero exit status 1.**

Debug info has been saved to /tmp/qiime2-q2cli-err-uzlzrwx9.log

cat /tmp/qiime2-q2cli-err-uzlzrwx9.log

ERROR:root:could not perform read merging with BBmerge. Error from BBmerge was:
java -ea -Xms300m -cp /home/u4040/miniconda3/envs/qiime2-2019.7/opt/bbmap-38.61b-0/current/ jgi.ReformatReads in=/tmp/qiime2-archive-s7ibswhq/0a04cfee-eab7-44cf-a88b-148c9071a7f5/data/S1_0_L001_R1_001.fastq.gz out=/tmp/itsxpress_p3vxjmwu/seq_r1.fq.gz out2=/tmp/itsxpress_p3vxjmwu/seq_r2.fq.gz
Executing jgi.ReformatReads [in=/tmp/qiime2-archive-s7ibswhq/0a04cfee-eab7-44cf-a88b-148c9071a7f5/data/S1_0_L001_R1_001.fastq.gz, out=/tmp/itsxpress_p3vxjmwu/seq_r1.fq.gz, out2=/tmp/itsxpress_p3vxjmwu/seq_r2.fq.gz]

Set INTERLEAVED to true
Input is being processed as paired
Changed from ASCII-33 to ASCII-64 on input ]: 93 -> 62

The ASCII quality encoding offset (64) is not set correctly, or the reads are corrupt; quality value below -5.
Please re-run with the flag ‘qin=33’, ‘ignorebadquality’, or ‘-da’.
Problematic read number 0:

@m54166_190711_083138/4325693/ccs
GCAGTCGAACATGTAGCTGACTCAGGTCACCCGTGTTTCAAGACGGGTCGCTTACGACCATTACGCCAGCGTCCGTGCCGAAGCGCGTTCCTCGGTCCGGGCTGGCCGCATTGCACCCCCGGCTATAAGACGCCCCGAAGGGCGACACATTCCGGGGGCCTTTGACCGACCGCCCAAACCGACGCTGGCCCGCCCGCGGGGGAGTGCACCGGCACGAGTGCCGGCTGAGCCCCCGCGGGCGAGTCTGGTCGCAAGCGCTTCCCTTTCAACAATTTCACGTGCTATTTAACTCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCCGGCCAGTATTTAGCTTTAGATGAAATTTACCACCCATTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAGGAGCTTCACACGGACGCGGCCACCCGTCCCAGACGGGATTCTCACCCTCTATGACGGCCCGTTCCAGGGCACTTAGACGGGGGCCGCACCCGAAGCATCCTCTGCAAATTACAACTCGGACCCCGACGGGGCCAGATTTCAAATTTGAGCTCTTGCCGCTTCACTCGCCGTTACTGGGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGAAAGAAGTGGTTGACTCGGCGGGCGCCGGCCGGGCCTGCAGAGCGGGTGACAGAGCCCCATACGCTCGAGGACCGGACGCGGCGCCGCCGCTGCCTTTCGGGCCCGTCCCCCCGCGGAGGGCGGGGACGGCGGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTCACGATTTCTCACGCGACTCAGACGACACGCCTTCACAGATCAGCGTTCACAGGGTCTCCGGCGGGCACGGGCCGGGGGGACGCCCCCCCGGCGGCCTTGCGGCGGGCCCGCCGAAGCAACACGGTACGGTAGACACGGGTGGGAGGTTGGGCCCCGAAGGACCCGCACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAAATGACCAAGCTACGATGTGATGCTTGCACAAGTGATCCAGTCGCACGTGTACGAC
+
@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@~y~}~e~V~~{K~hj~mw~i~vp{~b[email protected]eRyhy~{~xzys}}~}~i~~~[~b~q~q~b~~~X~a_~~|[~~~~~~~~~~~}~c~~^~~[a^@qX~~[email protected]~jE~o~a~q~y{[email protected]~~~z~~\~~{z~~~~~Y~~~~~~~~~~~~h~~~t~}[email protected]~~~~~~~~~Y~~~h~~~~~v~~e~~vW~~x~~|w~~~~]~~_~~~~~~J~~~G~~~~i~~~M~s~p^~vS~z^m~Te_\y~^zQjWv~~J~Z~dg~z~w~u~]Zh~c~g~~~xxA~Z~wnz~i~t}~j~~~}~p~xj~UI~~~p~j~kq~x~V~{~iB~w~abtOy}}~g~j~Dc@era[email protected]~Yx~Go~t~hZ~~~~}~r}~n[email protected]~s~n~m~~~d~]~pS~x~w~_x{~t~w~r~Tfc}~p~q~v~c~}Qo~U~O~pe~s~]q~m~sub~e~`r~rw~HL~s~~psX~}m[email protected]~w~s~qZ~jmv~T~jBnPxc~D~d~n~usbV~pz~rx{N~o~y~{~~~~~l~hx~~~~~~~~~~~|^~o~~~~|o~~~~~~~~~m

Offset=64
java.lang.Exception: Aborting.
at shared.KillSwitch.kill(KillSwitch.java:108)
at stream.FASTQ.quadToRead_slow(FASTQ.java:754)
at stream.FASTQ.toReadList(FASTQ.java:625)
at stream.FastqReadInputStream.fillBuffer(FastqReadInputStream.java:107)
at stream.FastqReadInputStream.hasMore(FastqReadInputStream.java:73)
at stream.ConcurrentGenericReadInputStream$ReadThread.readLists(ConcurrentGenericReadInputStream.java:667)
at stream.ConcurrentGenericReadInputStream$ReadThread.run(ConcurrentGenericReadInputStream.java:656)
Traceback (most recent call last):
File “/home/u4040/miniconda3/envs/qiime2-2019.7/lib/python3.6/site-packages/itsxpress/main.py”, line 603, in split_interleaved
p1.check_returncode()
File “/home/u4040/miniconda3/envs/qiime2-2019.7/lib/python3.6/subprocess.py”, line 369, in check_returncode
self.stderr)
subprocess.CalledProcessError: Command ‘[‘reformat.sh’, ‘in=/tmp/qiime2-archive-s7ibswhq/0a04cfee-eab7-44cf-a88b-148c9071a7f5/data/S1_0_L001_R1_001.fastq.gz’, ‘out=/tmp/itsxpress_p3vxjmwu/seq_r1.fq.gz’, ‘out2=/tmp/itsxpress_p3vxjmwu/seq_r2.fq.gz’]’ returned non-zero exit status 1.
Traceback (most recent call last):
File “/home/u4040/miniconda3/envs/qiime2-2019.7/lib/python3.6/site-packages/q2cli/commands.py”, line 327, in call
results = action(**arguments)
File “</home/u4040/miniconda3/envs/qiime2-2019.7/lib/python3.6/site-packages/decorator.py:decorator-gen-277>”, line 2, in trim_single
File “/home/u4040/miniconda3/envs/qiime2-2019.7/lib/python3.6/site-packages/qiime2/sdk/action.py”, line 240, in bound_callable
output_types, provenance)
File “/home/u4040/miniconda3/envs/qiime2-2019.7/lib/python3.6/site-packages/qiime2/sdk/action.py”, line 383, in callable_executor
output_views = self._callable(**view_args)
File “/home/u4040/miniconda3/envs/qiime2-2019.7/lib/python3.6/site-packages/q2_itsxpress/_itsxpress.py”, line 119, in trim_single
cluster_id=cluster_id)
File “/home/u4040/miniconda3/envs/qiime2-2019.7/lib/python3.6/site-packages/q2_itsxpress/_itsxpress.py”, line 193, in main
threads=threads)
File “/home/u4040/miniconda3/envs/qiime2-2019.7/lib/python3.6/site-packages/q2_itsxpress/_itsxpress.py”, line 72, in _set_fastqs_and_check
tempdir=None)
File “/home/u4040/miniconda3/envs/qiime2-2019.7/lib/python3.6/site-packages/itsxpress/main.py”, line 618, in init
self.split_interleaved()
File “/home/u4040/miniconda3/envs/qiime2-2019.7/lib/python3.6/site-packages/itsxpress/main.py”, line 609, in split_interleaved
raise e
File “/home/u4040/miniconda3/envs/qiime2-2019.7/lib/python3.6/site-packages/itsxpress/main.py”, line 603, in split_interleaved
p1.check_returncode()
File “/home/u4040/miniconda3/envs/qiime2-2019.7/lib/python3.6/subprocess.py”, line 369, in check_returncode
self.stderr)
subprocess.CalledProcessError: Command ‘[‘reformat.sh’, ‘in=/tmp/qiime2-archive-s7ibswhq/0a04cfee-eab7-44cf-a88b-148c9071a7f5/data/S1_0_L001_R1_001.fastq.gz’, ‘out=/tmp/itsxpress_p3vxjmwu/seq_r1.fq.gz’, ‘out2=/tmp/itsxpress_p3vxjmwu/seq_r2.fq.gz’]’ returned non-zero exit status 1.

What should I do bro?:expressionless:

There appears to be an issue with the plugin’s handling of single ended reads, the plug-in is trying to merge them. I will work on fixing it. Single end trimming should work in the stand-alone version of ITSxpress if you want to move forward with your work in the meantime.

1 Like

Really appreciated!:grin: