How to trim ransposase Adapters using qiime cutadapt or dada2 ?

Hi, I am a qiime2 beginner. I have a question regarding how to trim adapter sequences.

I used the following primers for my project.
1st PCR primer set

OpenNextera Transposase Adapters
The following transposase adapters are used for Nextera tagmentation.

Read 1 (NexXT338R-2(i5))
5′ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

Read 2 ( NexXT27F-2(i7) )
5′ GTCTCGTGGGGCTCGGGAGATGTGTATAAGAGACAG

OpenAdapter Trimming
The following sequence is used for Read 1 and Read 2 adapter trimming.

CTGTCTCTTATACACATCT

References; Sequences for Nextera, Illumina Prep, and Illumina PCR Kits

I would like to use cutadopt for this trimming.
If it is possible to trim in dada2, I would like to know how to do that as well.
Also, is it sufficient to trim only the Transposase Adoptors? Or should I trim only the OpenAdapter?

I would appreciate it if you could tell me.

Hello @yoshiki_usmle,

It is not possible to trim by sequence in dada2, only by position. It's common to trim using cutadapt first and then denoise with dada2. If you're unsure which adapters need to be trimmed you can try trimming both. That would look like running cutadapt with one adapter type, then running cutadapt again with the other adapter type on the trimmed sequences from the first run.

@colinvwood Thanks for your reply,
I will give it a try. By the way, is there any way to verify that the part I trimmed (adapter) is correct?
For example, if the part I trim is correct, the number of reads per sample will go up.

Also, does the difference in trimming position have a significant negative impact on the analysis?

Hello @yoshiki_usmle,

One way to see if your trimming was effective is to look at the read length distribution before and after in the demux visualizer. If trimming was effective, you will see the read lengths drop.

Also, does the difference in trimming position have a significant negative impact on the analysis?

Are you referring to the dada2 trimming/truncating positions?