Facing merging problem in dada2-plugin

Initially i am facing problem in filtering where very less reads have passed the filter. But now after setting q20, 50-60% reads passed the filter but I don't know why very less reads have passed on merging.
Can anyone help me to find solution to this problem?
Here I am attaching the denoising-stats report. Also I am attaching the command below.

qiime dada2 denoise-paired \
--i-demultiplexed-seqs paired-end-demux-trimmed-p-a.qza \
--p-trunc-len-f 0 \
--p-trim-left-f 0 \
--p-trunc-len-r 0 \
--p-trim-left-r 0 \
--p-trunc-q 20 \
--o-representative-sequences rep-seqs.qza \
--o-table table.qza \
--o-denoising-stats stats.qza

Thanks
Priyanka

Hi @Priyanka_Mishra,
I will need more info to help!
Can you attach your denoising-stats report and your paired-end-demux-trimmed-p-a.qzv?

If your sequences aren't merging, it is typically because they aren't long enough to cover the whole region with overlap. What variable region are you looking at and what are your primers?

Thanks
:turtle:

Hi @cherman2,
Hereby, I am attaching both the reports for more information. Thank you for your response.


Thanks,
Priyanka

Hi again @Priyanka_Mishra
What variable region are you looking at and what are your primers?

Hi Chloe,
Our variable region is V3-V4 region and the primers used were-
Primer Primer sequence 5' --> 3'
name
V3V4F - CCTACGGGNGGCWGCAG
V3V4R - GACTACHVGGGTATCTAATCC

Thanks,
Priyanka

Hi @Priyanka_Mishra,
Looking at all this data your reads should overlap, so this is weird.

It seems like there is enough length in your sequence to overlap but for some reason they are not overlapping. The only thing I can think of is something went wrong in the demux step and its making it so your data is randomly assigned to sequences and therefore the forward and reverse reads are not really meant to go together? I am not exactly sure. Can you attach/dm me your demux.qzv so I could take a look that would be very appreciated.

:turtle:

Hey @cherman2,
Okay sure I am attaching here my demux-p-a.qzv file for your reference.

Thanks,
Priyanka

demux-p-a-summary.qzv (327.7 KB)

Hi @Priyanka_Mishra,
Your demux file looks fine and your provenance makes sense to me. The last think that I can think of that might be effecting overlap is your adapters are still in the sequences? Do you know if your adapters are still in the sequence? If they are, you will want to use cutadapt to trim them out before dada2. Demultiplexing and Trimming Adapters from Reads with q2-cutadapt

Hope that helps!
:turtle:

Hi @cherman2 ,
I have already trimmed the adapter sequences using this command -

qiime cutadapt trim-paired \
--i-demultiplexed-sequences demux-paired-end.qza \
--p-adapter-f AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
--p-adapter-r AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
--o-trimmed-sequences paired-end-demux-trimmed.qza

How can I know that whether the adapters are removed or still there in the sequences after running this command?

Thanks,
Priyanka

Hi @Priyanka_Mishra,
I have one last idea, Have you tried searching for your primers after trimming to verify that they are being trimmed out?

We might have exhausted all options for trying to get these reads to merge and it might be best to proceed with just the forward reads.

:turtle:

Hi @cherman2 ,
Please can you help me out how to check whether the primers have been trimmed out or still there.

Thanks,
Priyanka

Hi @Priyanka_Mishra,
I think the simplest way to do this is to use command F /control F to search your fastq file after you have trimmed the adapters out of the sequences.

Hope that helps!
:turtle: