choice of fungal primers

General Discussion
1

Hi all,
I'm getting ready to place an order for barcoded primers that will be used for Illumina sequencing of host-associated and non-host-associated fungal communities. After doing some research on primers, I'm leaning toward ordering the ITS1f / ITS2 primers, which target the ITS1 region. (ITS1f: CTTGGTCATTTAGAGGAAGTAA; ITS2: GCTGCGTTCTTCATCGATGC; references for both are below.) These are the "Earth Microbiome Project ITS primers", described here and in Walters et al (2016), which is helpful because there will be a lot of pre-existing samples that were sequenced with these primers that we could compare against.

Before ordering I wanted to check if anyone had more recent recommendations on a good fungal ITS primer choice? It's been a few years since I've done any fungal community analysis work. Since these will be used to target host-associated and non-host-associated samples across a wide array of environment types, broad coverage is important. It's also important that there is existing taxonomic reference data (UNITE should work well for ITS1f / ITS2), and total amplicon length is important as we'll be starting with 2x300 Illumina runs.

The ITS1f / ITS4 pair also sounds nice since it covers both the ITS1 and ITS2 regions, but the amplicon is too long to be generally useful with Illumina sequencing (e.g., this came up on the forum here).

Another question: has anyone had experience (good or bad) with barcoding the ITS1f primer instead of the ITS2 primer? The EMP protocol puts the barcode on the ITS2 primer, but it seems like putting the barcode on the ITS1f could leave the door open to using this with the ITS4 primer in the future, e.g., if Illumina reads get considerably longer. (We're hoping to have this pool of barcoded primers for a while.)

References
ITS1f primer: Gardes M and Bruns T. 1993. ITS primers with enhanced specificity for basidiomycetes—application to the identification of mycorrhizae and rusts. Mol. Ecol. 2:113–118.)

ITS2 primer: White T, Burns T, Lee S, and Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p 315–322. In Innis MA, Gelfand DH, Sninsky JJ, and White TJ (ed), PCR protocols: a guide to methods and applications. Academic Press, San Diego, CA.

For reference, this diagram shows what the different primers target. I sourced this from one of @Nicholas_Bokulich's posts, and the original source is here.

Pasted image 20230308125328
Pasted image 20230308125328690Ă—391 19 KB

5 Likes
2

Hello Greg,

Great to hear you will be working on fungal metabarcoding. I recently started on a large ecology project (NEON) for which we are doing fungal ITS on soil and water samples (also bacterial 16S), and we are using the ITS1f/ITS2 primers. So far, they are working pretty well, though I haven't dug into the data enough yet to evaluate how much non-target or other problems there may be. The breadth of taxa that I have observed is pretty deep, with good representation of most major groups. I can post back as I know more.

My perspective on using the ITS1 region versus ITS2 is that ITS1 is a little better resolved, however, there is a lot of length variation across taxa. This will cause biases and the loss of some groups. I worked on a project in Norway for which we ran both ITS1 and ITS2, and one of the main target pathogens we were expecting to find in the data happened to have a big insert in the ITS1, so was missing almost entirely from that data set. The ITS2 worked much better. The ITS2 region is much more stable for length, so less of those kind of problems, but a little less resolved than ITS1 (still pretty good, though). That has been my experience, but others may counter this. It depends on the project/taxa etc.

For a couple of projects I worked on (the Norwegian one included), we had good results from using the gITS7/ITS4 primers to sequence the ITS2 region. The gITS7 primer (Ihrmark, 2012, New primers to amplify the fungal ITS2 region – evaluation by 454-sequencing of artificial and natural communities | FEMS Microbiology Ecology | Oxford Academic) is in the 5.8S region.

For fungal ITS, I consider Leho Tedersoo, at University of Tartu, Estonia, to be one of the leaders in the field. I came across a recent paper of his that is a good general survey, though some of it may be a bit basic for you. Nevertheless, a good place to start. Here is the link: https://doi.org/10.1111/mec.16460

I hope this helps. I look forward to hearing more about your work. Here at NEON we will probably stay with the ITS1 region, as it is a long-term project and we need consistency over the term of the project. I hope that in the future we can expand to run the entire ITS region, as you mention.

Cheers,
Hugh

4 Likes
3

@hugh, thanks for the reply and for the references. It's helpful to know that NEON is using ITS1F/ITS2.

I thought this was interesting from the Tedersoo et al 2022 paper: "For metabarcoding, ecologists use mostly primers designed decades ago for Sanger sequencing analyses (Figure 1; White et al., 1990). These original primers are not optimal for the many fungal groups that have one or more primer-template mismatches. They can be improved by adding degenerate positions to minimise primer bias (Tedersoo & Lindahl, 2016) and promote quantitative performance (Pinol et al., 2019). However, multiple degeneracies may require altering the 1:1 ratio of primers and may require extra PCR cycles, because not all primer variants match to templates. The broadly used fungus-specific forward primer ITS1F is particularly problematic because of several critical mismatches in certain groups of moulds and putative animal pathogens (Tedersoo & Lindahl, 2016). Researchers should also consider the common presence of an intron at the end of 18S rRNA gene, which prevents sequencing of the taxa with this intron (Figure 1). It may be important to pair primers with similar melting temperatures to attain optimal performance."

That bolded bit seems to align with your experience.

I'm still researching this to figure out exactly what we're going to do - unfortunately it doesn't seem like an easy answer. I'll follow up here when I make a decision to keep this discussion going, and I'd love to hear about what others think as well.

Thanks again!

5 Likes
4

Hello to both @gregcaporaso and @hugh,

Thank you for opening this discussion about ITS1 vs ITS2, and whether the "universal" ITS1f / ITS2 primer set may or may not be sufficient.

I am asking the same question for my project, and I wonder if you have come up with a decision and rational about which to use.

You're right, it is not an easy answer. I am also limited to the short read length of Illumina's NGS platform, or else I'd sequence the entire ITS region.

I would certainly appreciate any update to your opinion(s) on the matter!

~ Taylor

1 Like
6

Hi @Taylor_Akers, Welcome to the :qiime2: Forum!

I expect to make a decision on this after a couple of meetings I have scheduled this week and next week. I'll share where we end up after those meetings.

2 Likes
7

Welcome to the Qiime forum @Taylor_Akers ! It is a great community.

I look forward to hearing what @gregcaporaso decides. For our project, we will stick to the ITS1 region. As we are a long-term project (30 years), we strive to stay consistent. I hope that eventually we will move to sequencing the full ITS as sequencing technologies improve (whether Nanopore or some other). In the short term, if our budget improves, I would go to multiplexing multiple primers of the ITS1 to make up for deficiencies in any one primer set, as @gregcaporaso points out.

For what its worth, a little while ago I estimated the amplicon lengths from the ITS1f/ITS2 primers using the UNITE database. I did this because the lab we were using was deciding on Illumina kits and we wanted to see how many taxa we would lose by using the 2x250 chemistry instead of the 2x300 ('lost' taxa would be those for which the amplicon length would be longer than what could be fully sequenced with that chemistry). I estimated that less than 0.5% of the 27,000 taxa we checked would be too long. There were only a few taxa that would be salvaged with the longer chemistry. There are a few taxa in this database that had ITS1 regions over 1 kb in length! Of course, we could have a whole other thread about pros and cons of the UNITE database, but I think it is still the best there is right now (I would love to hear dissenting voices from the community--we want to use the best!).

Just one other note: we have switched to a new lab to run both fungal ITS and bacterial 16S for NEON, and they are great. They have made great improvements in our fungal ITS sequencing. We will publish their protocols on the NEON website and as a separate peer-reviewed publication soon. Perhaps these protocols would be useful to you, @Taylor_Akers

Hugh

2 Likes
11

Hi all, Just a quick reply: I haven't forgotten about this discussion, just haven't made a decision yet.

12

Since you are leaning towards targeting the ITS1, you should also consider using the ITS1catta forward primer from Leho Tedesoo's group. They used it for PacBio sequencing (which is HIGHLY recommended for fungi) along with ITS4ngsUni reverse primer. If you cannot use PacBio then you could use the gITS7ngs reverse primer instead also from Leho's group. ITS1catta is recommended because it binds just upstream of the intron present in only some fungal taxa and so avoids the amplification bias caused by this intron. Also, like ITSF1 it doesn't bind plant sequences which was really useful for my data where the target tissue was plant roots and I had virtually no plant sequences in my final results.

P.S. Leho's group advocates for not using DADA2 pipeline for ITS given the larger variation of this region even within a species and so you might consider going for a good ol 97% clustering approach

2 Likes
13

Thanks for the input @mikki!

14

Thanks for the warm welcome & encouragement @gregcaporaso & @hugh!

I went with the ITS1f/ITS2 "universal" pair for now. I'm just a grad student getting started in the field, so I figure it will suffice. But in the future, I will definitely look into using multiple primer pairs to capture more taxa.

Cheers!

1 Like
15

Hello everyone @hugh @gregcaporaso , sorry to join this chat later...

Right now I am doing the PCR with the primers suggested by the EMP ITS1f - ITS2 (ITS Illumina Amplicon Protocol : earthmicrobiome ).
By running the electrophoresis, I obtained "strange" results, with different bands at ~350bp, and then other some times more evident at ~800bp, ~1100bp.

I know that the ITS1 region can have different lengths from 100bp to 1000bp but the despite this I am not so sure about my results.
According to the website of EMP is not clear about the length of the amplicon. And also this protocol (EMP ITS Illumina Amplicon Protocol) says that the amplicon should be around 230bp.

Can you please help me to understand if these results are in common also with you and if you have any tips about this topic are welcome.

Thank you in advance.
Lorenzo

16

Hi all, We've decided on my end to not pursue new primers right now. We're curious to see if longer-read technologies will give some better options over the next year, and we've decided that ITS sequencing isn't urgent for the project my lab is currently running. I'm guessing I'll be checking back in in about a year to see where things are and if we're going to pursue new primers.

I did come across this page on UNITE's website recently though, which has a ton of information about fungal primers.

Good luck with your fungal sequencing everyone. Please do feel free to continue the discussion here, and especially to share what worked and didn't work so others can learn from it!

:mushroom:

4 Likes
18

Hi,
I'd like to use the ITS1catta primer, however, I cannot find a reverse primer that would be suited to generate an amplicon which can be utilised in Illumina sequencing platforms.
Do you happen to know of any?

19

Hi @Caleb_Sheff, I don't know offhand, but we'll leave this message queued for a few more days in case any of the other moderators have ideas for you. Good luck!