choice of fungal primers

[gregcaporaso]

Hi all,
I'm getting ready to place an order for barcoded primers that will be used for Illumina sequencing of host-associated and non-host-associated fungal communities. After doing some research on primers, I'm leaning toward ordering the ITS1f / ITS2 primers, which target the ITS1 region. (ITS1f: CTTGGTCATTTAGAGGAAGTAA; ITS2: GCTGCGTTCTTCATCGATGC; references for both are below.) These are the "Earth Microbiome Project ITS primers", described here and in Walters et al (2016), which is helpful because there will be a lot of pre-existing samples that were sequenced with these primers that we could compare against.

Before ordering I wanted to check if anyone had more recent recommendations on a good fungal ITS primer choice? It's been a few years since I've done any fungal community analysis work. Since these will be used to target host-associated and non-host-associated samples across a wide array of environment types, broad coverage is important. It's also important that there is existing taxonomic reference data (UNITE should work well for ITS1f / ITS2), and total amplicon length is important as we'll be starting with 2x300 Illumina runs.

The ITS1f / ITS4 pair also sounds nice since it covers both the ITS1 and ITS2 regions, but the amplicon is too long to be generally useful with Illumina sequencing (e.g., this came up on the forum here).

Another question: has anyone had experience (good or bad) with barcoding the ITS1f primer instead of the ITS2 primer? The EMP protocol puts the barcode on the ITS2 primer, but it seems like putting the barcode on the ITS1f could leave the door open to using this with the ITS4 primer in the future, e.g., if Illumina reads get considerably longer. (We're hoping to have this pool of barcoded primers for a while.)

References
ITS1f primer: Gardes M and Bruns T. 1993. ITS primers with enhanced specificity for basidiomycetes—application to the identification of mycorrhizae and rusts. Mol. Ecol. 2:113–118.)

ITS2 primer: White T, Burns T, Lee S, and Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p 315–322. In Innis MA, Gelfand DH, Sninsky JJ, and White TJ (ed), PCR protocols: a guide to methods and applications. Academic Press, San Diego, CA.

For reference, this diagram shows what the different primers target. I sourced this from one of @Nicholas_Bokulich's posts, and the original source is here.

[hugh]

Hello Greg,

Great to hear you will be working on fungal metabarcoding. I recently started on a large ecology project (NEON) for which we are doing fungal ITS on soil and water samples (also bacterial 16S), and we are using the ITS1f/ITS2 primers. So far, they are working pretty well, though I haven't dug into the data enough yet to evaluate how much non-target or other problems there may be. The breadth of taxa that I have observed is pretty deep, with good representation of most major groups. I can post back as I know more.

My perspective on using the ITS1 region versus ITS2 is that ITS1 is a little better resolved, however, there is a lot of length variation across taxa. This will cause biases and the loss of some groups. I worked on a project in Norway for which we ran both ITS1 and ITS2, and one of the main target pathogens we were expecting to find in the data happened to have a big insert in the ITS1, so was missing almost entirely from that data set. The ITS2 worked much better. The ITS2 region is much more stable for length, so less of those kind of problems, but a little less resolved than ITS1 (still pretty good, though). That has been my experience, but others may counter this. It depends on the project/taxa etc.

For a couple of projects I worked on (the Norwegian one included), we had good results from using the gITS7/ITS4 primers to sequence the ITS2 region. The gITS7 primer (Ihrmark, 2012, New primers to amplify the fungal ITS2 region – evaluation by 454-sequencing of artificial and natural communities | FEMS Microbiology Ecology | Oxford Academic) is in the 5.8S region.

For fungal ITS, I consider Leho Tedersoo, at University of Tartu, Estonia, to be one of the leaders in the field. I came across a recent paper of his that is a good general survey, though some of it may be a bit basic for you. Nevertheless, a good place to start. Here is the link: https://doi.org/10.1111/mec.16460

I hope this helps. I look forward to hearing more about your work. Here at NEON we will probably stay with the ITS1 region, as it is a long-term project and we need consistency over the term of the project. I hope that in the future we can expand to run the entire ITS region, as you mention.

Cheers,
Hugh

[gregcaporaso]

@hugh, thanks for the reply and for the references. It's helpful to know that NEON is using ITS1F/ITS2.

I thought this was interesting from the Tedersoo et al 2022 paper: "For metabarcoding, ecologists use mostly primers designed decades ago for Sanger sequencing analyses (Figure 1; White et al., 1990). These original primers are not optimal for the many fungal groups that have one or more primer-template mismatches. They can be improved by adding degenerate positions to minimise primer bias (Tedersoo & Lindahl, 2016) and promote quantitative performance (Pinol et al., 2019). However, multiple degeneracies may require altering the 1:1 ratio of primers and may require extra PCR cycles, because not all primer variants match to templates. The broadly used fungus-specific forward primer ITS1F is particularly problematic because of several critical mismatches in certain groups of moulds and putative animal pathogens (Tedersoo & Lindahl, 2016). Researchers should also consider the common presence of an intron at the end of 18S rRNA gene, which prevents sequencing of the taxa with this intron (Figure 1). It may be important to pair primers with similar melting temperatures to attain optimal performance."

That bolded bit seems to align with your experience.

I'm still researching this to figure out exactly what we're going to do - unfortunately it doesn't seem like an easy answer. I'll follow up here when I make a decision to keep this discussion going, and I'd love to hear about what others think as well.

Thanks again!