Start qiime2 with fasta

I do not have sequence raw data,only own fasta data which has been removed the primers、low quality base and barcode. In this case How can i start qiime2 with fasta.

Hi @sumujin1! Can you please provide the following info?

  1. Have the sequences been demultiplexed already?
  2. Can you send me the first 10-20 lines from your fasta file(s)?

Thanks!

@jairideout I think i have demultiplexed the sequences.I will show you the fasta files

1DH006_120 HWI-D00621:415:HMNH2BCXX:2:2215:12563:64804 orig_bc=TAAGGCGACTCTCTAT new_bc=TAAGGCGACTCTCTAT bc_diffs=0
GATGAACGCTAGCTACAGGCTTAACACATGCAAGTCGAGGGGCAGCATGGTCTTAGCTTGCTAAGGCCGATGGCGACCGGCGCACGGGTGAGTAACACGTATCCAACCTGCCGTCTACTCTTGGACAGCCTTCTGAAAGGAAGATTAATACAAGATGGCATCATGAGTCCGCATGTTCACATGATTAAAGGTATTCCGGTAGACGATGGGGATGCGTTCCATTAGATAGTAGGCGGGGTAACGGCCCACCTAGTCTTCGATGGATAGGGGTTCTGAGAGGAAGGTCCCCCACATTGGAACTGAGACACGGTCCAAACTCCTACGGGAGGCAGC
1DH006_174 HWI-D00621:415:HMNH2BCXX:2:2215:13296:64860 orig_bc=TAAGGCGACTCTCTAT new_bc=TAAGGCGACTCTCTAT bc_diffs=0
GATGAACGCTAGCGACAGGCTTAACACATGCAAGTCGAGGGGTAGCACGGTGTAGCAATACACTGGTGGCGACCGGCGCACGGGTGAGTAACACGTGTGCAACCAACCCCGTACCGGGAGATAACCCGCGGAAACGTGGACTAACATCCCATAAGACTCTAGAGCCGCATGGCTCTGGATTTAAAATTCCGGTGGTACGGGACGGGCACGCGCGACATTAGGTAGTTGGCGGGGTAACGGCCCACCAAGCCGACGATGTCTAGGGGTTCTGAGAGGAAGGTCCCCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGC
1DH006_251 HWI-D00621:415:HMNH2BCXX:2:2215:14613:64756 orig_bc=TAAGGCGACTCTCTAT new_bc=TAAGGCGACTCTCTAT bc_diffs=0
ATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAGCGGTAGCACAGAGAGCTTGCTCTCGGGTGGCGAGCGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAATGTCGCAAGACCAAAGTGGGGGACCTTCGGGCCTCATGCCATCAGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGC
1DH006_278 HWI-D00621:415:HMNH2BCXX:2:2215:14786:64855 orig_bc=TAAGGCGACTCTCTAT new_bc=TAAGGCGACTCTCTAT bc_diffs=0
GATGAACGCTAGCTACAGGCTTAACACATGCAAGTCGAGGGGAAACGATATTGGAAGCTTGCTTCCGATAGGCGTCGACCGGCGCACGGGTGAGTAACGCGTATCCAACCTGCCCATCACTTGGGGATAACCTTGCGAAAGTAAGACTAATACCCAATGACGTCTCTAGAAGACATCTGAAAGGGATTAAAGATTTATCGGTGATGGATGGGGATGCGTCTGATTAGCTTGTTGGCGGGGTAACGGCCCACCAAGGCGACGATCAGTAGGGGTTCTGAGAGGAAGGTCCCCCACATTGGAACTGAGACACGGTCCAAACTCCTACGGGAGGCAGC
1DH006_283 HWI-D00621:415:HMNH2BCXX:2:2215:14931:64931 orig_bc=TAAGGCGACTCTCTAT new_bc=TAAGGCGACTCTCTAT bc_diffs=0
GATGAACGCTAGCTACAGGCTTAACACATGCAAGTCGAGGGGCAGCGGGATTGAAGCTTGCTTCAATTGCCGGCGACCGGCGCACGGGTGAGTAACGCGTATCCAACCTTCCGTACACTCAGGGATAGCCTTTCGAAAGAAAGATTAATACCTGATAGTATCTTAAGCACACATGTAATTAAGATTAAAGATTTATCGGTGTACGATGGGGATGCGTTCCATTAGGTAGTAGGCGGGGTAACGGCCCACCTAGCCGACGATGGATAGGGGTTCTGAGAGGAAGGTCCCCCACATTGGAACTGAGACACGGTCCAAACTCCTACGGGAGGCAGC
1DH006_623 HWI-D00621:415:HMNH2BCXX:2:2215:15168:64969 orig_bc=TAAGGCGACTCTCTAT new_bc=TAAGGCGACTCTCTAT bc_diffs=0
ATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGCAGCTTGCTGCTTCGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGC
1DH006_834 HWI-D00621:415:HMNH2BCXX:2:2215:18505:64911 orig_bc=TAAGGCGACTCTCTAT new_bc=TAAGGCGACTCTCTAT bc_diffs=0
GATGAACGCTAGCTACAGGCTTAACACATGCAAGTCGAGGGGCAGCATCATCAAAGCTTGCTTTGATGGATGGCGACCGGCGCACGGGTGAGTAACACGTATCCAACCTGCCGACAACACTGGGATAGCCTTTCGAAAGAAAGATTAATACCGGATGGCATAGTTTTCCCGCATGGGATGATTATTAAAGAATTTCGGTTGTCGATGGGGATGCGTTCCATTAGGCAGTTGGCGGGGTAACGGCCCACCAAACCAACGATGGATAGGGGTTCTGAGAGGAAGGTCCCCCACATTGGAACTGAGACACGGTCCAAACTCCTACGGGAGGCAGC
1DH006_859 HWI-D00621:415:HMNH2BCXX:2:2215:19187:64851 orig_bc=TAAGGCGACTCTCTAT new_bc=TAAGGCGACTCTCTAT bc_diffs=0
GACGAACGCTGGCGGCGCGCCTAACACATGCAAGTCGAACGGAGCTGAGAGGAGCTTGCTTTTCTCAGCTTAGTGGCGAACGGGTGAGTAACGTGTGAGTAACCTGCCCTGGAGTGGGGGACAACAGTTGGAAACGACTGCTAATACCGCATAAGCCCACGGATTCGCATGGATCTGCGGGATAAGGATTTATTCGCTTCAGGATGGACTCGCGTCCAATTAGCTAGTAGGTGAGGTAACGGCTCACCTAGGCGACGATACATAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGC
1DH006_1120 HWI-D00621:415:HMNH2BCXX:2:2215:8103:65142 orig_bc=TAAGGCGACTCTCTAT new_bc=TAAGGCGACTCTCTAT bc_diffs=0
GATGAACGCTAGCGGCAGGCCTAACACATGCAAGTCGAGGGGCAGCACGGTGTAGCAATACACTGGTGGCGACCGGCGCACGGGTGCGTAACGCGTATGCAACCTACCCATAACAGGGGGATAACACTGAGAAATTGGTACTAATACCCCATAACATCAGGACCGGCATCGGTTCTGGTTGAAAACTCCGGTGGTTATGGATGGGCATGCGTTGTATTAGCTGGTTGGTGAGGTAACGGCTCACCAAGGCAACGATACATAGGGGGACTGAGAGGTTAACCCCCCACATTGGTACTGAGACACGGACCAAACTCCTACGGGAGGCAGC
I have installed qiime2 successfully,but i can not begin my analysis with fasta files. When do DADA2,(--i-demultiplexed-seqs demux.qza),the demultiplexed-seqs demux.qza contains fastq files.Can i do _Sequence quality control and feature table construction_with my fasta files.
Thank you very much.

Thanks for those details @sumujin1! Can you please provide the following info? Sorry that I didn’t gather this info when I first replied to you.

  1. Are these FASTA files generated from an Illumina machine (e.g. MiSeq) or something else (e.g. 454)?

  2. Are all the data from a single sequencing run or from multiple runs?

  3. Which marker gene(s) are repesented by these data (e.g. 16S, ITS)?

These details will affect how the data are processed by downstream methods such as DADA2, so I want to make sure I give you accurate advice. Thanks!

Thanks for your reply.
1.These FASTA files are generated from the MiSeq of Illumina machine .
2.All the data are from a single sequencing run .If they are from multiple runs,what should i do?
3.for 16S
Thanks!

Thanks for info! Are you wanting to perform OTU picking, or denoising (e.g. with DADA2 or Deblur) on your sequence data? If you plan to use an OTU picking strategy, you don’t need quality scores, but if you’re planning to denoise your data, we’ll need quality scores (i.e. .qual files) associated with your sequence data so that we can convert the .fna and .qual files into .fastq format. Let me know how you’re planning to analyze your data and we can figure out how best to proceed.

If you have sequence data from multiple runs and plan to denoise with DADA2, it’s recommended to process each run separately and merge the results (see the FMT tutorial for examples).

@jairideout When i do DADA2,
qiime dada2 denoise-single _
_ --i-demultiplexed-seqs demux.qza _
_ --p-trim-left 0 _
_ --p-trunc-len 120 _
_ --o-representative-sequences rep-seqs-dada2.qza _
_ --o-table table-dada2.qza

It comes
Plugin error from dada2:
_ An error was encountered while running DADA2 in R (return code 1), please inspect stdout and stderr to learn more._
Debug info has been saved to /tmp/qiime2-q2cli-err-0ouxx11j.log
qiime2-q2cli-err-0ouxx11j.txt (2.4 KB)
Thank you for help.

Hey @sumujin1,

You’re probably seeing that because there isn’t any quality information. What commands did you use to convert and/or import your data to get that demux.qza file?

Thanks!

This topic was automatically closed 31 days after the last reply. New replies are no longer allowed.