Stand Alone Cutadapt automation or plugin update?

[1119 (Arnon)]

Hey All,
Im working on Fungi database and i was following the Q2-ITS2 tutorial.
Unfortunately the ITS2 trimming left the primers on most of my reads so i decided to use Cutadapt before moving forward with the tutorial.

As some of you know, Q2-cutadapt is bugged so it was suggested to use it as a stand alone and import the data to q2 after trimming the primers. Since i have more then 2000 Fastq.gz paired end files.
i need a way to automate it. I saw some solutions online but i could not make them work for me.

[thermokarst]

@1119

As some of you know, Q2-cutadapt is bugged

I am not sure I follow - can you provide some context? Perhaps a link or two about the specific issue you are referring to?

[1119 (Arnon)]

Yes, This is the bug: Cutadapt thinks my fastq.gz files aren't fastq.gz.

I tried to run it again today and the process actually finished without this bug.
But it didn't managed to cut my primers, maybe because i am not using the plugin correctly?

This is my primers:
My forward primer is: (ITS86F) - GTGAATCATCGAATCTTTGAA
My reverse primer is : (ITS4) - TCCTCCGCTTATTGATATGC

Since im working with ITS2 - in some of my reads there is a chance my sequence include the reverse complementary primer on the 3' strand and subsequent bases. So in order to remove them as well i want to ask Cutadapt the following:
On the forward reads remove: forward primer + reverse complementary of the reverse primer.
On the reverse reads remove: reverse primer + reverse complementary of the forward primer.
This is what i ran in the command line:

i also uploaded the qzv of rep-seqs - as you can see in 9 out of 60 samples the Reverse complementary of the ITS4 primer wasn't removed.

lastly, i uploaded the filtering stats, i am losing most of my data even though i trimmed by quality up until the mean was above 20.

rep-seqs.qzv (212.9 KB)
stats-dada2.qzv (1.2 MB)

[thermokarst]

Thanks for clarifying, @1119 — sounds like you didn’t need to worry about that missing feature in the first place, since things “worked” for you.

If you have questions about cutadapt and how to use it, please check out the cutadapt docs, there are lots of great examples and the instructions are very clear. q2-cutadapt simply wraps a few cutadapt commands. Keep us posted!

[1119 (Arnon)]

I read all the documentation and I tried to play around with different commands and combination, i even tried using “linked adapters” but nothing works as planned. i paid attention to Reverse complementary, i read different posts about cutadapt in the forum, in order to find a solution, but nothing helped. apparently im still missing something. maybe you can advise me on what i should try writing in q2-cutadapt?
@Nicholas_Bokulich
@thermokarst

[thermokarst]

Have you tried anchoring?