Hi @Liviacmg,
I just wanted to qiime-in (hahaha)! I think that you want to provide the reverse-compliment of the reverse primer to --p-adapter
flag. You can use this handy online tool to reverse compliment your primer.
That is, your command should be:
qiime cutadapt trim-single
--i-demultiplexed-sequences single-end-demux.qza
--p-cores 6
--p-front AGAGTTTGATCCTGGCTCAG
--p-adapter ACTCCTACGGGAGGCAGCATG
--p-discard-untrimmed
--output-dir trim.cutadapt
Or reverse compliment the other primer and swap the primers you feed into --p-front
and --p-adapter
, depending on the orientation of the reads