Regarding the presence of primer sequences on reads after primer removal using cutadapt

[SoilRotifer (Mike Robeson)]

@microbiome_25

Could you please let me know if it is common not to remove reverse-complementary strand primer sequences in reads?

I'd suggest reading the plugin help text and the cutadapt documentation regarding adapter types. There are also a few examples of this in the forum. See:

Removal of primers from single-end sequences not working properly

Hi @Liviacmg, I just wanted to qiime-in (hahaha)! I think that you want to provide the reverse-compliment of the reverse primer to --p-adapter flag. You can use this handy online tool to reverse compliment your primer. That is, your command should be: qiime cutadapt trim-single --i-demultiplexed-sequences single-end-demux.qza --p-cores 6 --p-front AGAGTTTGATCCTGGCTCAG --p-adapter ACTCCTACGGGAGGCAGCATG --p-discard-untrimmed --output-dir trim.cutadapt Or reverse compliment the other primer and…

and

qiime cutadapt trim-single too many short reads

In that case, you should use the the --p-adapter to remove the reverse compliment sequences from the 3' end and any sequence after it, whereas the --p-front flag is intended to start searching from the 5' end and remove any extra sequence before it. The latter case is why you had too many short reads as it is finding the reverse compliment towards the 3' end and then removing it and any sequence before it. If you read the help text you'll see that you should set up your command like : qiime …

@microbiome_25

Is it common to keep these reads with primer sequences due to the possible biological significance of the primer sequences present in reads, or should they be removed as errors?

They should always be removed as the primers can make sequences appear more similar to each other then they actually are (and contribute to chimera checking problems). Remember that the PCR primers can bind with a reasonable amount of mismatches and become part of the sequenced amplicon itself. That is, due to the amplicon being PCR amplified each cycle and then finally sequenced. The area to which the primer binds will be the sequence of the primer itself, which may not necessarily be the actual sequence from the organism you are sequencing. Hence it is a good idea to remove the primer sequence prior to constructing OTUs/ESV, and phylogenies.

@microbiome_25

I searched for primer sequences using the following commands in the Mac Terminal.
For the forward reads, I executed the following command.

I am not sure why you are still observing primers.