Removal of primers from single-end sequences not working properly

Hey guys,

I have single-end sequences from a public dataset, and there is a pair of primers reported on the study:

V1-V2 region of the 16S rRNA gene 338R (5’- CATGCTGCCTCCCGTAGGAGT-3’ and 27 F (5’-AGAGTTTGATCCTGGCTCAG-3’)"

Then I searched for them on the fastq sequences with grep:

grep -c "CATGCTGCCTCCCGTAGGAGT" *.fastq #reverse

grep -c "AGAGTTTGATCCTGGCTCAG" *.fastq #forward

And then only reverse primers revealed a lot of sequences:

Then I tried to trimm it differently 2 times (one including both forward and reverse primers and other only including reverse primers):

qiime cutadapt trim-single
--i-demultiplexed-sequences single-end-demux.qza
--p-cores 6
--p-front AGAGTTTGATCCTGGCTCAG
--p-adapter CATGCTGCCTCCCGTAGGAGT
--p-discard-untrimmed
--output-dir trim.cutadapt

qiime cutadapt trim-single
--i-demultiplexed-sequences single-end-demux.qza
--p-cores 6
--p-adapter CATGCTGCCTCCCGTAGGAGT
--p-discard-untrimmed
--output-dir trim.cutadapt

But the result was super weird:

The single-end-demux

After trimming the first time (both forward and reverse primers)

Trying to trimm a second time (only with reverse primer)

I'm posting the single end demux and the trimmed results if you want to see details. Can you help me? Am I doing something wrong?

single-end-demux.qzv (311.3 KB)
trimmed_sequences.qzv (309.1 KB)
trimmed_sequences2.qzv (306.7 KB)

And then as a result when I try to run DADA2 with trimmed_sequences (first attempt) it simply won't work properly as well.. I got results such as 0 of non-chimeric inputs, 0 filtered etc

Thank you in advance!

Hello @Liviacmg. Apologies for the somewhat delayed response. Many of the people who would normally answer questions like this are currently traveling.

Can you try swapping the primers so --p-adapter AGAGTTTGATCCTGGCTCAG and --p-front CATGCTGCCTCCCGTAGGAGT ?

EDIT: Prefer @SoilRotifer's solution to mine, he knows a lot more about this than I do!

Hi @Liviacmg,

I just wanted to qiime-in (hahaha)! I think that you want to provide the reverse-compliment of the reverse primer to --p-adapter flag. You can use this handy online tool to reverse compliment your primer.

That is, your command should be:

qiime cutadapt trim-single
--i-demultiplexed-sequences single-end-demux.qza
--p-cores 6
--p-front AGAGTTTGATCCTGGCTCAG
--p-adapter ACTCCTACGGGAGGCAGCATG
--p-discard-untrimmed
--output-dir trim.cutadapt

Or reverse compliment the other primer and swap the primers you feed into --p-front and --p-adapter, depending on the orientation of the reads

Hi @Oddant1 ,

Thank you for the reply! I tried with your approach and it looked like this:

But now I saw your edit that I should follow @SoilRotifer advice hehe

Hi @SoilRotifer ,

Ooh, thank you so much!! I didn't know about it! I saw it in another post you replied, but to be honest I was only able to understand it right now hehe.

So, the output with your approach looked like this:

Thank you so much :slight_smile:

Glad I could help! :slight_smile: