Hello yanxianl
I have a question regarding downloading the sequences by clicking on Add sequences to cart, the page offers different types of downloads, which one did you use?
Hello yanxianl
I have a question regarding downloading the sequences by clicking on Add sequences to cart, the page offers different types of downloads, which one did you use?
I think "FASTA without gaps" makes sense for most Qiime2 workflows.
'gappy' implies that MSA has been used to align conserved regions, and some programs including mothur use aligned fasta files. Depends on the program. ![]()
I download a 'FASTA without gaps' file to test it: Note the 'U' as expected
$ head -n 5 arb-silva.de_2024-04-15_id1319684_tax_silva_trunc.fasta
>HG530135.546799.549813 Bacteria;Firmicutes;Clostridia;Clostridiales;Clostridiaceae;Clostridium sensu stricto 15;Clostridium tetani 12124569
UACAAUAACAAAUGUCCCACGGAGGACAAGCUUCUUAUUGAAAUAUUAGAAGUUAAGGUUCACUUCAAAAACUAAUUUAA
GAAAAAAAUAAAUUAGUGUUGACAAAACAAAUUUGAAGUUGUAUACUGUAAAAGUCGCUUGAGUGCGACAAACAAAUAGG
UCUUUGAAAAUUAAACAGAGAAAUAAGCCAGUCGAUUCUUAUUGAGAAUCAAAAAAAUAGUAAUUGAGCAAGGUUUUAUC
AAUUAUAUUAGUUGAUAAAGACUAAACGAGUUCGAUCCUGGCUCAGGAUGAACGCUGGCGGCGUGCUUAACACAUGCAAG
In the 5 years since this question was posted, we now have a new tool for extracting reads from a database and matching PCR primer locations. Check it out! ![]()
Thank you very much and very kind for helping me resolve my doubts.