Hi, I am trying to use this command
qiime cutadapt trim-single
--i-demultiplexed-sequences single-end-demux.qza
--p-front CCTGTCAGATCAAAAACGAC CAGGAACTACATCACAATAAC GTCGTTTTTGATCTGACAGG GTTATTGTGATGTAGTTCCTG
--p-overlap 3
--p-error-rate 0.1
--p-match-read-wildcards
--p-match-adapter-wildcards
--p-discard-untrimmed
--o-trimmed-sequences primer-trimmed-demux.qza
--verbose > cutadapt-log-3.txt
And found around 45% reads are too short.
Here is the log file:
cutadapt-log-3.txt (7.6 KB)
Here is the fastqc report for the reads file
fastqc_data.txt (296.9 KB)
Could anyone let me know why this large portion of short reads? How to solve the issue?
Thank you!
Junli
Is there a reason why you are also searching for and removing the reverse compliments? If you look at the cutadapt output for the positional information of adapter/primer 1 & 2, you can see that they are cutting were expected, at the 5' end.
Whereas adapter/primer 3 & 4 appear to be spuriously cutting all throughout sequence, especially primer/adapter 4.
You should be fine with the first two sequences, unless there is something I am mmissing.
Because when I tried to use the reverse complement to search the sequence file, I found that all the four primers can be found. My sequencing results are like ITS, some reads are read through reads.
But thank you for the reminder, I may delete the 3rd and 4th primers to try again.
Thank you!
Junli
In that case, you should use the the --p-adapter to remove the reverse compliment sequences from the 3' end and any sequence after it, whereas the --p-front flag is intended to start searching from the 5' end and remove any extra sequence before it. The latter case is why you had too many short reads as it is finding the reverse compliment towards the 3' end and then removing it and any sequence before it.
If you read the help text you'll see that you should set up your command like :
qiime cutadapt trim-single \
--i-demultiplexed-sequences single-end-demux.qza
--p-front CCTGTCAGATCAAAAACGAC CAGGAACTACATCACAATAAC \
--p-adapter GTCGTTTTTGATCTGACAGG GTTATTGTGATGTAGTTCCTG \
--p-overlap 3 \
--p-error-rate 0.1 \
--p-match-read-wildcards \
--p-match-adapter-wildcards \
--p-discard-untrimmed \
--o-trimmed-sequences primer-trimmed-demux.qza \
--verbose > cutadapt-log-3.txt
Thank you! This is very helpful. I have been wondering how to trim the primer on the 3-prime end.
Junli