Hi all,
I’m trying to trim from 16S amplicon sequence the primers (27F, 534R).
I get blank outputs files as if the software cut the entire sequence and not just the primer - what could be the problem?
This is the command I wrote down:
“cutadapt -a AGAGTTTGATCCTGGCTCAG -A ATTACCGCGGCTGCTGG -M 20 -o S2.FW.0.F_trimmed7.fastq -p S2.FW.0.R_trimmed7.fastq S2.FW.0
.F.fastq S2.FW.0.R.fastq”
Thanks
Hi @michal_ln,
Welcome to the forum!
I’m by no means a cutadapt expert, but:
from the cutadapt manual:
--maximum-length LENGTH or -M LENGTH
Discard processed reads that are longer than LENGTH. Reads that are too long even before adapter removal are also discarded.
Sounds like you’re instructing cutadapt to discard any processed reads that are longer than 20 nt, which I’m guessing is all of your reads, therefore you get a blank output. Try changing that to something more reasonable.