Primer sequences still present in representative-sequences after running ITSxpress

[Pablo_V]

Hi,

I have received de-multiplexed sequences from the sequencing facility and I have trimmed the ITS1 primers I have used using the following cutadapt command:

qiime cutadapt trim-paired \ 

  --i-demultiplexed-sequences fun-rz-rt-demux.qza \ 

  --p-anywhere-f CTTGGTCATTTAGAGGAAGTAA \ 

  --p-anywhere-r GCTGCGTTCTTCATCGATGC \ 

  --o-trimmed-sequences fun-rz-rt-demux-trimmed2.qza \ 

Then I used this trimmed sequences as input for ITSxpress in the QIIME2 2023.5 using the following command:

qiime itsxpress trim-pair-output-unmerged\
  --i-per-sample-sequences demux-sequences-trimmedprimers.qza \
  --p-region ITS2 \
  --p-taxa F \
  --p-cluster-id 1.0 \
  --p-threads 16 \
  --o-trimmed trimmed_exact.qza

Then I ran DADA2 with the output obtained and conducted taxonomic assignation. The resulting table had 21.9K features, which is half as much in comparison to the number of features obtained without trimming the primers from the intput sequences.

However, now when I check the rep-seqs file, I see a lot of my forward and reverse primer sequences in the rep-seqs sequences.

My main concern would be, if it is alright to find back my primer sequences in the representative sequences.

I feel there might be a mistake in my pipeline since when I check for differentially abundant features with LEfSe, I get none after p-adjustment with FDR.

Thank you for your support.

[SoilRotifer (Mike Robeson)]

Hi @Pablo_V,

I suggest reading these posts:

ITS data in QIIME2

Hi @mycol, Your overall strategy appears fine. I assume when taking into account reading through into the opposing primer at the 3' end of the reads you are doing so by feeding cutadapt the reverse-compliment of that opposing primer sequence? I ask because, it is often forgotten to take the reverse compliment. If not, this may explain why so few reads are merged/returned via DADA2, as the opposing primer is contained within both of the R1 and R2 reads. Also, make sure you've not trimmed to muc…

Do i need to remove the primer sequences (cutadapt) before using ItSxpress for Fungal ITS data or the hmm matching and trimming can handle that for me?

Hi @sudhir19, It has been a long while since I've used ITSxpress, but my recollection is that it is better leave the primers in the sequences for ITSxpress. Doing so will make it easier for the model to find and extract the ITS sequences. But things may have changed since I've used this... Perhaps others with more recent experience can comment on this? -Mike

In brief, the primer sequences make it easier for tools like ITS express / ITSx, etc... to find and extract the region of interest. This will potentially result in keeping more ITS reads. So, I'd skip the cutadapt step and simply jump right into itsexpress. This is basically what I do whenever I need to process ITS data.

-Mike