Primer naming inconsistencies?

General Discussion
,
1

Hi there!

So far, I have only worked with V3-V4 amplicons and therefore I never noticed this. However, recently I got involved with a V1-V2 project and there is something that got me really confused: it looks like the 27F primer (AGAGTTTGATCCTGGCTCAG; for sources of the sequence see e.g. [1] or [2]) commonly used for amplifying V1-V2 binds before the 27th basepair (i.e. the last nt in the primer binds to the 27th bp in the 16S gene), whereas the 341F primer (CCTACGGGNGGCWGCAG; see [2] or [3]) usually used for V3-V4 binds from 341-357 (i.e. after 341 bp).

I noticed this when removing primers from my reads and then checked it by blasting both primers against multiple E. coli strains (I guess the 16S gene of E. coli was the original reference used to infer the locations). You can find some exemplary screenshots below.

I looked for literature or forum posts about this, but did not find anything. Is there a reason for this inconsistency in naming the primers? Does it have any implications? Or am I missing something obvious here?

Thanks for any input!

This is the Blast result of 27F against the 16S gene of MG1655 as an example -- the last nt is at location 27.

image
image883×215 25.4 KB

For 341F, however, the first nt is at location 341.

image
image885×210 25.8 KB

1 Like
2

I don't know anything about the V1–V2 primers, but this sounds a bit like the situation with the V3–V4 primers (see this forum post). I think if you named each of the V3–V4 primers based on where their 5' end nucleotide binds in the E. coli genome, they'd be 341F/805R, but if you named them based on the lowest value position at which any nucleotide of the primer binds in the E. coli genome, they'd be 341F/785R. I'm not sure if there's an agreed-upon convention for primer naming, but in the case of the V3–V4 primers, I've seen both name combinations used. Certainly a tad confusing for newbies like myself!

2 Likes
3

Thanks for pointing that out, @KQUB! I have seen the post when searching earlier, but in this particular case it made more sense to me because it is the reverse primer. However, I suspected different forward primers to be consistently named, but I guess you are right and there is no convention.