Plugin Error from Cutadapt

Running QIIME 2018.4 in an Oracle Virtual Box 5.2.12.

Demultiplexing data from an Ion Torrent run using the Metagenomics 16S kit with multiple primers. Using the primer + barcode sequence to demultiplex which worked fine with the V3 region forward primer. Now trying it with the V4 forward primer and getting the following error. I see that someone else ran into the problem but it looks like there was only an off-line workaround:

Plugin error from cutadapt:

  /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-96dkgf5s/48_^AACCATCCGCGATACTGAGACACGGTCCAGACTCCTACGG_L001_R1_001.fastq.gz is not a(n) FastqGzFormat file:

  Missing sequence for record beginning on line 5

Full text below. Any hlep you could provide would be greatly appreciated. Thanks!

[email protected]:~$ qiime cutadapt demux-single --i-seqs multiplexed-seqs-2.qza --m-barcodes-file metadata_V3F_primer-2.tsv --m-barcodes-column BarcodeSequence --p-error-rate 0 --o-per-sample-sequences demultiplexed-seqs_V3F-2.qza --o-untrimmed-sequences untrimmed_V3F-2.qza --verbose
Running external command line application. This may print messages to stdout and/or stderr.
The command being run is below. This command cannot be manually re-run as it will depend on temporary files that no longer exist.

Command: cutadapt --front file:/tmp/tmpg5ve1157 --error-rate 0.0 -o /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-96dkgf5s/{name}.1.fastq.gz --untrimmed-output /tmp/q2-MultiplexedSingleEndBarcodeInSequenceDirFmt-qgb5h9fq/forward.fastq.gz /tmp/qiime2-archive-v_5_oaws/72148ae6-d0f2-49f0-81ec-4fa1bd2eee5e/data/forward.fastq.gz

This is cutadapt 1.16 with Python 3.5.5
Command line parameters: --front file:/tmp/tmpg5ve1157 --error-rate 0.0 -o /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-96dkgf5s/{name}.1.fastq.gz --untrimmed-output /tmp/q2-MultiplexedSingleEndBarcodeInSequenceDirFmt-qgb5h9fq/forward.fastq.gz /tmp/qiime2-archive-v_5_oaws/72148ae6-d0f2-49f0-81ec-4fa1bd2eee5e/data/forward.fastq.gz
Running on 1 core
Trimming 46 adapters with at most 0.0% errors in single-end mode ...
Finished in 303.48 s (109 us/read; 0.55 M reads/minute).

=== Summary ===

Total reads processed:               2,778,271
Reads with adapters:                   320,099 (11.5%)
Reads written (passing filters):     2,778,271 (100.0%)

Total basepairs processed:   581,744,202 bp
Total written (filtered):    568,812,451 bp (97.8%)

=== Adapter 14 ===

Sequence: AAGAGGATTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 7078 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	7078	0.0	0	7078

=== Adapter 18 ===

Sequence: TACCAAGATCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 7603 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	7603	0.0	0	7603

=== Adapter 21 ===

Sequence: CAGAAGGAACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 8512 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	8512	0.0	0	8512

=== Adapter 23 ===

Sequence: CTGCAAGTTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 4723 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	4723	0.0	0	4723

=== Adapter 25 ===

Sequence: TTCGTGATTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 4035 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	4035	0.0	0	4035

=== Adapter 26 ===

Sequence: TTCCGATAACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 5642 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	5642	0.0	0	5642

=== Adapter 27 ===

Sequence: TGAGCGGAACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 7032 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	7032	0.0	0	7032

=== Adapter 29 ===

Sequence: CTGACCGAACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 5603 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	5603	0.0	0	5603

=== Adapter 30 ===

Sequence: TCCTCGAATCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 11774 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	11774	0.0	0	11774

=== Adapter 31 ===

Sequence: TAGGTGGTTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 7931 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	7931	0.0	0	7931

=== Adapter 33 ===

Sequence: TCTAACGGACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 9151 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	9151	0.0	0	9151

=== Adapter 34 ===

Sequence: TTGGAGTGTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 7264 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	7264	0.0	0	7264

=== Adapter 35 ===

Sequence: TCTAGAGGTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 8940 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	8940	0.0	0	8940

=== Adapter 36 ===

Sequence: TCTGGATGACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 8836 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	8836	0.0	0	8836

=== Adapter 37 ===

Sequence: TCTATTCGTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 6339 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	6339	0.0	0	6339

=== Adapter 38 ===

Sequence: AGGCAATTGCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 5213 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	5213	0.0	0	5213

=== Adapter 39 ===

Sequence: TTAGTCGGACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 8097 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	8097	0.0	0	8097

=== Adapter 40 ===

Sequence: CAGATCCATCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 7934 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	7934	0.0	0	7934

=== Adapter 41 ===

Sequence: TCGCAATTACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 9725 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	9725	0.0	0	9725

=== Adapter 42 ===

Sequence: TTCGAGACGCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 8294 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	8294	0.0	0	8294

=== Adapter 43 ===

Sequence: TGCCACGAACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 12230 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	12230	0.0	0	12230

=== Adapter 44 ===

Sequence: AACCTCATTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 7410 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	7410	0.0	0	7410

=== Adapter 46 ===

Sequence: CCTGAGATACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 5668 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	5668	0.0	0	5668

=== Adapter 47 ===

Sequence: TTACAACCTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 4682 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	4682	0.0	0	4682

=== Adapter 48 ===

Sequence: AACCATCCGCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 5354 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	5354	0.0	0	5354

=== Adapter 49 ===

Sequence: ATCCGGAATCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 9178 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	9178	0.0	0	9178

=== Adapter 50 ===

Sequence: TCGACCACTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 11108 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	11108	0.0	0	11108

=== Adapter 52 ===

Sequence: CGAGGTTATCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 5661 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	5661	0.0	0	5661

=== Adapter 53 ===

Sequence: TCCAAGCTGCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 5880 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	5880	0.0	0	5880

=== Adapter 55 ===

Sequence: TCTTACACACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 5332 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	5332	0.0	0	5332

=== Adapter 56 ===

Sequence: TTCTCATTGAACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 42; Trimmed: 5390 times.

No. of allowed errors:
0-42 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
42	5390	0.0	0	5390

=== Adapter 57 ===

Sequence: TCGCATCGTTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 41; Trimmed: 4863 times.

No. of allowed errors:
0-41 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
41	4863	0.0	0	4863

=== Adapter 58 ===

Sequence: TAAGCCATTGTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 42; Trimmed: 5663 times.

No. of allowed errors:
0-42 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
42	5663	0.0	0	5663

=== Adapter 59 ===

Sequence: AAGGAATCGTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 41; Trimmed: 3743 times.

No. of allowed errors:
0-41 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
41	3743	0.0	0	3743

=== Adapter 60 ===

Sequence: CTTGAGAATGTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 42; Trimmed: 4710 times.

No. of allowed errors:
0-42 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
42	4710	0.0	0	4710

=== Adapter 61 ===

Sequence: TGGAGGACGGACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 42; Trimmed: 5031 times.

No. of allowed errors:
0-42 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
42	5031	0.0	0	5031

=== Adapter 62 ===

Sequence: TAACAATCGGCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 41; Trimmed: 6841 times.

No. of allowed errors:
0-41 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
41	6841	0.0	0	6841

=== Adapter 63 ===

Sequence: CTGACATAATCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 41; Trimmed: 8117 times.

No. of allowed errors:
0-41 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
41	8117	0.0	0	8117

=== Adapter 64 ===

Sequence: TTCCACTTCGCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 41; Trimmed: 4471 times.

No. of allowed errors:
0-41 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
41	4471	0.0	0	4471

=== Adapter 66 ===

Sequence: AGCACGAATCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 7391 times.

No. of allowed errors:
0-40 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
40	7391	0.0	0	7391

=== Adapter 67 ===

Sequence: CTTGACACCGCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 41; Trimmed: 5593 times.

No. of allowed errors:
0-41 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
41	5593	0.0	0	5593

=== Adapter 69 ===

Sequence: TTGGAGGCCAGCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 42; Trimmed: 5477 times.

No. of allowed errors:
0-42 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
42	5477	0.0	0	5477

=== Adapter 70 ===

Sequence: TGGAGCTTCCTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 42; Trimmed: 6549 times.

No. of allowed errors:
0-42 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
42	6549	0.0	0	6549

=== Adapter 72 ===

Sequence: TCAGTCCGAACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 41; Trimmed: 10813 times.

No. of allowed errors:
0-41 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
41	10813	0.0	0	10813

=== Adapter 73 ===

Sequence: TAAGGCAACCACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 42; Trimmed: 4492 times.

No. of allowed errors:
0-42 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
42	4492	0.0	0	4492

=== Adapter 74 ===

Sequence: TTCTAAGAGACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 41; Trimmed: 8726 times.

No. of allowed errors:
0-41 bp: 0

Overview of removed sequences
length	count	expect	max.err	error counts
41	8726	0.0	0	8726

Traceback (most recent call last):
  File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/qiime2/plugin/model/file_format.py", line 24, in validate
    self._validate_(level)
  File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/q2_types/per_sample_sequences/_format.py", line 159, in _validate_
    self._check_n_records(record_count_map[level])
  File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/q2_types/per_sample_sequences/_format.py", line 130, in _check_n_records
    % (i * 4 + 1))
qiime2.plugin.model.base.ValidationError: Missing sequence for record beginning on line 5

The above exception was the direct cause of the following exception:

Traceback (most recent call last):
  File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/q2cli/commands.py", line 274, in __call__
    results = action(**arguments)
  File "<decorator-gen-368>", line 2, in demux_single
  File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/qiime2/sdk/action.py", line 231, in bound_callable
    output_types, provenance)
  File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/qiime2/sdk/action.py", line 366, in _callable_executor_
    output_views = self._callable(**view_args)
  File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/q2_cutadapt/_demux.py", line 126, in demux_single
    return _demux(seqs, barcodes, error_rate, untrimmed)
  File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/q2_cutadapt/_demux.py", line 112, in _demux
    muxed = len(list(per_sample_sequences.sequences.iter_views(FastqGzFormat)))
  File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/qiime2/plugin/model/directory_format.py", line 141, in iter_views
    yield fp.relative_to(root), transformation(fp)
  File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/qiime2/core/transform.py", line 68, in transformation
    self.validate(view)
  File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/qiime2/core/transform.py", line 143, in validate
    view.validate('min')
  File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/qiime2/plugin/model/file_format.py", line 29, in validate
    ) from e
qiime2.plugin.model.base.ValidationError: /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-96dkgf5s/48_^AACCATCCGCGATACTGAGACACGGTCCAGACTCCTACGG_L001_R1_001.fastq.gz is not a(n) FastqGzFormat file:

Missing sequence for record beginning on line 5

Plugin error from cutadapt:

  /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-96dkgf5s/48_^AACCATCCGCGATACTGAGACACGGTCCAGACTCCTACGG_L001_R1_001.fastq.gz is not a(n) FastqGzFormat file:

  Missing sequence for record beginning on line 5

See above for debug info.

Hey there @dwh2102!

The workaround is posted near the end of that thread:

This hasn't been dealt with in q2-cutadapt yet, due to some blocking design decisions that need to happen first. Please see this open issue. In the meantime, the workaround above is the best solution we have to offer you at the moment. Thanks! :qiime2:

This topic was automatically closed 31 days after the last reply. New replies are no longer allowed.