Running QIIME 2018.4 in an Oracle Virtual Box 5.2.12.
Demultiplexing data from an Ion Torrent run using the Metagenomics 16S kit with multiple primers. Using the primer + barcode sequence to demultiplex which worked fine with the V3 region forward primer. Now trying it with the V4 forward primer and getting the following error. I see that someone else ran into the problem but it looks like there was only an off-line workaround:
Plugin error from cutadapt:
/tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-96dkgf5s/48_^AACCATCCGCGATACTGAGACACGGTCCAGACTCCTACGG_L001_R1_001.fastq.gz is not a(n) FastqGzFormat file:
Missing sequence for record beginning on line 5
Full text below. Any hlep you could provide would be greatly appreciated. Thanks!
qiime2@qiime2core2018-4:~$ qiime cutadapt demux-single --i-seqs multiplexed-seqs-2.qza --m-barcodes-file metadata_V3F_primer-2.tsv --m-barcodes-column BarcodeSequence --p-error-rate 0 --o-per-sample-sequences demultiplexed-seqs_V3F-2.qza --o-untrimmed-sequences untrimmed_V3F-2.qza --verbose
Running external command line application. This may print messages to stdout and/or stderr.
The command being run is below. This command cannot be manually re-run as it will depend on temporary files that no longer exist.
Command: cutadapt --front file:/tmp/tmpg5ve1157 --error-rate 0.0 -o /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-96dkgf5s/{name}.1.fastq.gz --untrimmed-output /tmp/q2-MultiplexedSingleEndBarcodeInSequenceDirFmt-qgb5h9fq/forward.fastq.gz /tmp/qiime2-archive-v_5_oaws/72148ae6-d0f2-49f0-81ec-4fa1bd2eee5e/data/forward.fastq.gz
This is cutadapt 1.16 with Python 3.5.5
Command line parameters: --front file:/tmp/tmpg5ve1157 --error-rate 0.0 -o /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-96dkgf5s/{name}.1.fastq.gz --untrimmed-output /tmp/q2-MultiplexedSingleEndBarcodeInSequenceDirFmt-qgb5h9fq/forward.fastq.gz /tmp/qiime2-archive-v_5_oaws/72148ae6-d0f2-49f0-81ec-4fa1bd2eee5e/data/forward.fastq.gz
Running on 1 core
Trimming 46 adapters with at most 0.0% errors in single-end mode ...
Finished in 303.48 s (109 us/read; 0.55 M reads/minute).
=== Summary ===
Total reads processed: 2,778,271
Reads with adapters: 320,099 (11.5%)
Reads written (passing filters): 2,778,271 (100.0%)
Total basepairs processed: 581,744,202 bp
Total written (filtered): 568,812,451 bp (97.8%)
=== Adapter 14 ===
Sequence: AAGAGGATTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 7078 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 7078 0.0 0 7078
=== Adapter 18 ===
Sequence: TACCAAGATCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 7603 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 7603 0.0 0 7603
=== Adapter 21 ===
Sequence: CAGAAGGAACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 8512 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 8512 0.0 0 8512
=== Adapter 23 ===
Sequence: CTGCAAGTTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 4723 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 4723 0.0 0 4723
=== Adapter 25 ===
Sequence: TTCGTGATTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 4035 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 4035 0.0 0 4035
=== Adapter 26 ===
Sequence: TTCCGATAACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 5642 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 5642 0.0 0 5642
=== Adapter 27 ===
Sequence: TGAGCGGAACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 7032 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 7032 0.0 0 7032
=== Adapter 29 ===
Sequence: CTGACCGAACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 5603 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 5603 0.0 0 5603
=== Adapter 30 ===
Sequence: TCCTCGAATCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 11774 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 11774 0.0 0 11774
=== Adapter 31 ===
Sequence: TAGGTGGTTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 7931 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 7931 0.0 0 7931
=== Adapter 33 ===
Sequence: TCTAACGGACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 9151 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 9151 0.0 0 9151
=== Adapter 34 ===
Sequence: TTGGAGTGTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 7264 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 7264 0.0 0 7264
=== Adapter 35 ===
Sequence: TCTAGAGGTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 8940 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 8940 0.0 0 8940
=== Adapter 36 ===
Sequence: TCTGGATGACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 8836 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 8836 0.0 0 8836
=== Adapter 37 ===
Sequence: TCTATTCGTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 6339 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 6339 0.0 0 6339
=== Adapter 38 ===
Sequence: AGGCAATTGCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 5213 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 5213 0.0 0 5213
=== Adapter 39 ===
Sequence: TTAGTCGGACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 8097 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 8097 0.0 0 8097
=== Adapter 40 ===
Sequence: CAGATCCATCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 7934 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 7934 0.0 0 7934
=== Adapter 41 ===
Sequence: TCGCAATTACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 9725 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 9725 0.0 0 9725
=== Adapter 42 ===
Sequence: TTCGAGACGCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 8294 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 8294 0.0 0 8294
=== Adapter 43 ===
Sequence: TGCCACGAACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 12230 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 12230 0.0 0 12230
=== Adapter 44 ===
Sequence: AACCTCATTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 7410 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 7410 0.0 0 7410
=== Adapter 46 ===
Sequence: CCTGAGATACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 5668 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 5668 0.0 0 5668
=== Adapter 47 ===
Sequence: TTACAACCTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 4682 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 4682 0.0 0 4682
=== Adapter 48 ===
Sequence: AACCATCCGCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 5354 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 5354 0.0 0 5354
=== Adapter 49 ===
Sequence: ATCCGGAATCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 9178 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 9178 0.0 0 9178
=== Adapter 50 ===
Sequence: TCGACCACTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 11108 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 11108 0.0 0 11108
=== Adapter 52 ===
Sequence: CGAGGTTATCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 5661 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 5661 0.0 0 5661
=== Adapter 53 ===
Sequence: TCCAAGCTGCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 5880 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 5880 0.0 0 5880
=== Adapter 55 ===
Sequence: TCTTACACACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 5332 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 5332 0.0 0 5332
=== Adapter 56 ===
Sequence: TTCTCATTGAACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 42; Trimmed: 5390 times.
No. of allowed errors:
0-42 bp: 0
Overview of removed sequences
length count expect max.err error counts
42 5390 0.0 0 5390
=== Adapter 57 ===
Sequence: TCGCATCGTTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 41; Trimmed: 4863 times.
No. of allowed errors:
0-41 bp: 0
Overview of removed sequences
length count expect max.err error counts
41 4863 0.0 0 4863
=== Adapter 58 ===
Sequence: TAAGCCATTGTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 42; Trimmed: 5663 times.
No. of allowed errors:
0-42 bp: 0
Overview of removed sequences
length count expect max.err error counts
42 5663 0.0 0 5663
=== Adapter 59 ===
Sequence: AAGGAATCGTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 41; Trimmed: 3743 times.
No. of allowed errors:
0-41 bp: 0
Overview of removed sequences
length count expect max.err error counts
41 3743 0.0 0 3743
=== Adapter 60 ===
Sequence: CTTGAGAATGTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 42; Trimmed: 4710 times.
No. of allowed errors:
0-42 bp: 0
Overview of removed sequences
length count expect max.err error counts
42 4710 0.0 0 4710
=== Adapter 61 ===
Sequence: TGGAGGACGGACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 42; Trimmed: 5031 times.
No. of allowed errors:
0-42 bp: 0
Overview of removed sequences
length count expect max.err error counts
42 5031 0.0 0 5031
=== Adapter 62 ===
Sequence: TAACAATCGGCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 41; Trimmed: 6841 times.
No. of allowed errors:
0-41 bp: 0
Overview of removed sequences
length count expect max.err error counts
41 6841 0.0 0 6841
=== Adapter 63 ===
Sequence: CTGACATAATCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 41; Trimmed: 8117 times.
No. of allowed errors:
0-41 bp: 0
Overview of removed sequences
length count expect max.err error counts
41 8117 0.0 0 8117
=== Adapter 64 ===
Sequence: TTCCACTTCGCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 41; Trimmed: 4471 times.
No. of allowed errors:
0-41 bp: 0
Overview of removed sequences
length count expect max.err error counts
41 4471 0.0 0 4471
=== Adapter 66 ===
Sequence: AGCACGAATCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 40; Trimmed: 7391 times.
No. of allowed errors:
0-40 bp: 0
Overview of removed sequences
length count expect max.err error counts
40 7391 0.0 0 7391
=== Adapter 67 ===
Sequence: CTTGACACCGCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 41; Trimmed: 5593 times.
No. of allowed errors:
0-41 bp: 0
Overview of removed sequences
length count expect max.err error counts
41 5593 0.0 0 5593
=== Adapter 69 ===
Sequence: TTGGAGGCCAGCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 42; Trimmed: 5477 times.
No. of allowed errors:
0-42 bp: 0
Overview of removed sequences
length count expect max.err error counts
42 5477 0.0 0 5477
=== Adapter 70 ===
Sequence: TGGAGCTTCCTCGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 42; Trimmed: 6549 times.
No. of allowed errors:
0-42 bp: 0
Overview of removed sequences
length count expect max.err error counts
42 6549 0.0 0 6549
=== Adapter 72 ===
Sequence: TCAGTCCGAACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 41; Trimmed: 10813 times.
No. of allowed errors:
0-41 bp: 0
Overview of removed sequences
length count expect max.err error counts
41 10813 0.0 0 10813
=== Adapter 73 ===
Sequence: TAAGGCAACCACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 42; Trimmed: 4492 times.
No. of allowed errors:
0-42 bp: 0
Overview of removed sequences
length count expect max.err error counts
42 4492 0.0 0 4492
=== Adapter 74 ===
Sequence: TTCTAAGAGACGATACTGAGACACGGTCCAGACTCCTACGG; Type: anchored 5'; Length: 41; Trimmed: 8726 times.
No. of allowed errors:
0-41 bp: 0
Overview of removed sequences
length count expect max.err error counts
41 8726 0.0 0 8726
Traceback (most recent call last):
File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/qiime2/plugin/model/file_format.py", line 24, in validate
self._validate_(level)
File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/q2_types/per_sample_sequences/_format.py", line 159, in _validate_
self._check_n_records(record_count_map[level])
File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/q2_types/per_sample_sequences/_format.py", line 130, in _check_n_records
% (i * 4 + 1))
qiime2.plugin.model.base.ValidationError: Missing sequence for record beginning on line 5
The above exception was the direct cause of the following exception:
Traceback (most recent call last):
File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/q2cli/commands.py", line 274, in __call__
results = action(**arguments)
File "<decorator-gen-368>", line 2, in demux_single
File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/qiime2/sdk/action.py", line 231, in bound_callable
output_types, provenance)
File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/qiime2/sdk/action.py", line 366, in _callable_executor_
output_views = self._callable(**view_args)
File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/q2_cutadapt/_demux.py", line 126, in demux_single
return _demux(seqs, barcodes, error_rate, untrimmed)
File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/q2_cutadapt/_demux.py", line 112, in _demux
muxed = len(list(per_sample_sequences.sequences.iter_views(FastqGzFormat)))
File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/qiime2/plugin/model/directory_format.py", line 141, in iter_views
yield fp.relative_to(root), transformation(fp)
File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/qiime2/core/transform.py", line 68, in transformation
self.validate(view)
File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/qiime2/core/transform.py", line 143, in validate
view.validate('min')
File "/home/qiime2/miniconda/envs/qiime2-2018.4/lib/python3.5/site-packages/qiime2/plugin/model/file_format.py", line 29, in validate
) from e
qiime2.plugin.model.base.ValidationError: /tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-96dkgf5s/48_^AACCATCCGCGATACTGAGACACGGTCCAGACTCCTACGG_L001_R1_001.fastq.gz is not a(n) FastqGzFormat file:
Missing sequence for record beginning on line 5
Plugin error from cutadapt:
/tmp/q2-CasavaOneEightSingleLanePerSampleDirFmt-96dkgf5s/48_^AACCATCCGCGATACTGAGACACGGTCCAGACTCCTACGG_L001_R1_001.fastq.gz is not a(n) FastqGzFormat file:
Missing sequence for record beginning on line 5
See above for debug info.
