My libraries contain reads from _two_ variable regions - how can I proceed with the analysis?

[Nicholas_Bokulich]

Hi @bmb22,

I think I have a better understanding of the problem now.

@bmb22

it would have been better if I had designed it so the different regions had different indexes and could have pulled each out during demultiplexing.

Definitely much easier.

@bmb22

• the V1-V3 region from the kit is ~650 bp, but I did the 300 cycles PE (and only the reverse primer has the index). Therefore, I am not sure these can overlap for joining, and not sure how to use Qiime here.

Yep, sounds like you do not have enough overlap to use paired-end for V1-V3. You will need to analyze just the forward or reverse reads as single-end data. See q2-cutadapt for details on demultiplexing with barcodes inside the reads.

@bmb22

only the reverse primer has the index

Thanks for that information. That actually makes this much easier, because now you can split out these regions during demultiplexing. Your reverse reads probably look like this:

barcode linker primer read
bbbbbbbbbLLppppppppppACTGACTGATCGATCGTAGC

So in your sample metadata file (where barcodes are listed), just add the linker and part of the primer sequence (any conserved sections at the 5' end, cut it off before any degenerate bases) to your barcode sequences. Since those linkers/primers will be different for each of your primer set, voila.

Note that you will also need to use q2-cutadapt to trim out any remaining primer segments from your reads following the tutorial linked above.

@bmb22

If I were to do the extract-reads and exclude seqs, is this before or after quality filtering?

Don't worry about this anymore — splitting via demultiplexing will be easier. But otherwise this would actually occur after denoising/OTU picking, so much later in the workflow.

@bmb22

From my understanding, the next steps I should take are OTU picking, but I don’t know how to do that for the V1-V3 (even if I have extracted those sequences)

Have you had a chance to check out our tutorials? In particular, the moving pictures tutorial could give you a good sense of what to do after demultiplexing. We recommend denoising methods (dada2 or deblur) as described in that tutorial as a replacement for OTU picking — however, if OTU picking is your preference, see this tutorial for some options.

I hope that helps!