My libraries contain reads from _two_ variable regions - how can I proceed with the analysis?

Hi @bmb22,

I think I have a better understanding of the problem now.

Definitely much easier.

Yep, sounds like you do not have enough overlap to use paired-end for V1-V3. You will need to analyze just the forward or reverse reads as single-end data. See q2-cutadapt for details on demultiplexing with barcodes inside the reads.

Thanks for that information. That actually makes this much easier, because now you can split out these regions during demultiplexing. Your reverse reads probably look like this:

barcode linker primer read
bbbbbbbbbLLppppppppppACTGACTGATCGATCGTAGC

So in your sample metadata file (where barcodes are listed), just add the linker and part of the primer sequence (any conserved sections at the 5' end, cut it off before any degenerate bases) to your barcode sequences. Since those linkers/primers will be different for each of your primer set, voila.

Note that you will also need to use q2-cutadapt to trim out any remaining primer segments from your reads following the tutorial linked above.

Don't worry about this anymore — splitting via demultiplexing will be easier. But otherwise this would actually occur after denoising/OTU picking, so much later in the workflow.

Have you had a chance to check out our tutorials? In particular, the moving pictures tutorial could give you a good sense of what to do after demultiplexing. We recommend denoising methods (dada2 or deblur) as described in that tutorial as a replacement for OTU picking — however, if OTU picking is your preference, see this tutorial for some options.

I hope that helps!