Importing OTUs in fasta format with associated frequency table

Hi,

I have data in the form of a fasta file of OTUs and an associated file with the presence and frequency information plus a metadata file. How do I import this into qiime2? I don't need to denoise or cluster, just build up the sampledata[sequences] and FeatureTable[Frequency] objects.

So I have, for example the following:
'''
">OTU1
TAGCAAGAAACATTGCTCATGCCGGCCCATCTGTAGACTT

">OTU2
TCTAGCTAGAAATCTCGCTCATGCGGGGCCATCAGTAGAT

">OTU3
ACTCTCCGGGAACATAACCCATGCCGGTCCATCCGTAGAC
'''

Along with a frequency table
'''

Sample1 Sample2 Sample3 Sample4
OTU1 4700 500 1200 0
OTU2 200 0 4800 75
OTU3 0 0 560 1500
'''
How do I import and/or merge these files along with the metadata to work with them in qiime2?

I can also get them in a single tsv where each line consists of:
'''
||OTUname|Sequence|Freq_sample1|Freq_sample2|Freq_sample3|

'''
if that would be easier...

Thanks for all your help.

Hi, @David_Pearton !
Welcome back to the forum!
Did you check already importing tutorial? I think it contains all information you need to import your data to Qiime2!
Let us know if you have some dificulties with data import that are not covered in tutorial.