Importing NCBI SRA sequences

[Fra (Francesco)]

Hello everyone,

I have downloaded some sequences from NCBI and I am having some troubles uploading them into qiime. The sequences are forward and reverse and look like this:

@SRR8243471.1 1 length=301
GATGAACGCTAGCGGCAGGCTTAACACATGCAAGTCGAGGGGTAACATTGATTTCTTTCAATCCGCTGTCTACCCGCTCACGTGTTATTAACTCTTATGCAACCTACCTTCTACAGTTGTTTATTCCTTAGAACTGTTTATTAATACCCCATAATTTCATTATTCCACATATATTTTTTATTAAATCTCCTGCTGTATAATATCGTCATTCTTCCTTTTATTTTTTTGGTAAGTTAACTGCTTACCTATACTTCGTTACTTAGGTTTCCTTATATGTACATCCCCCCCCCTGGTACCGAGT
+SRR8243471.1 1 length=301
9CCCCGGGGGGEGGGGGGGGGGGGGGGGGFF9CECF;,+8@+8,,;,,,,,<C,6CC,6,,9:@+:@+,:,,<6,+8+8+:,,,:,,,<,,:,9,<,<,9,,544,94?A=?,,,,,,,,,9,,99,,9,,,,,9,9A,,,9,,7,75A=+8,,,,76,8@,,37=,,,6,,,383@B+,,,,,,,63=2,,1,,7,,+,++5+++5+0+3+59,:+59++4=++3:*@CA66+4++0++*14+2)****00/4((-((31)))))9.69)+))).)))...,/1((-(-)((.).)((((
@SRR8243471.2 2 length=300

Would somebody help me to choose which --type I should use in my "qiime tools import" command?

Thanks
Francesco

[Nicholas_Bokulich]

Hi @Fra ,

Check out this new tutorial, it might save you a few steps:

q2-fondue: Plugin for (meta)data retrieval from SRA

q2-fondue: (meta)data retrieval from SRA made simple Hello QIIMErs! On behalf of the Bokulich Lab team I would like to present to you our brand new plugin: q2-fondue (Functions for reproducibly Obtaining and Normalizing Data re-Used from Elsewhere)! q2-fondue allows you to grab any sequence data from the Sequence Read Archive (SRA) and corresponding metadata, given a list of SRA run accession IDs or BioProject IDs. Naturally, the resulting artifacts can then be directly plugged into …

Otherwise you can check out the importing tutorial at docs.qiime2.org . The --type depends on various characteristics of the data, so you can check out that tutorial to see which type makes sense for your data.

Good luck!