Importing FASTA sequences for feature-table building

User Support
,
1

Hi there!
I am a new one in QIIME and I tried to import a FASTA file in this command:

qiime tools import
–input-path FL.fasta
–output-path seqs_FL.qza
–type 'FeatureData[Sequence]'

The FASTA file(FL.fasta) looked like this:

gi|16127|emb|X54946.1| A.tamarense 18S
ACCTGGTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTCAGTATAAGCTTTCATTTTGTGAAACTGCAAATGGCTCATTAAAACAGTTATAATGTATTTGACAATCAACTCTATATGGATATCTGT
gi|41392031|emb|AJ535150.1| Achnanthes bongranii
CTGGTTGATCCTGCCAGTAGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAACTCTTTTACTTGAAAACTGCGAACGGCTCATTATATCAGTTATAGTTTATTGGATAGTCCCTTACTACTTGGATAACCGTA

After I imported the data, I tried to get the feature table using this command:

qiime vsearch dereplicate-sequences
--i-sequences seqs_FL.qza
--o-dereplicated-table table_FL.qza
--o-dereplicated-sequences rep-seqs_FL.qza

which got an error:

Plugin error from vsearch:
Parameter 'sequences' received an argument of type FeatureData[Sequence]. An argument of subtype SampleData[JoinedSequencesWithQuality] | SampleData[SequencesWithQuality] | SampleData[Sequences] is required.

Anybody got an idea about how to get the fearture table, which using fasta file for import?

2

Hey there @Hty!

Well, your error message provides a pretty solid hint:

Your file seqs_FL.qza is of type FeatureData[Sequence], but the derep action needs SampleData[...].

Is FL.fasta a QIIME 1 style post-split_libraries output? If so, you can import as SampleData[Sequences], check out this tutorial for more info:

https://docs.qiime2.org/2018.11/tutorials/otu-clustering/

3

Thank you for the reply!

Well, my import FASTA file was downloaded from the NCBI Nucleotide database, which do not have information about the original and error-corrected barcodes from which this inference was made.

The FASTA file(FL.fasta) looked like this:

gi|16127|emb|X54946.1| A.tamarense 18S
ACCTGGTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTCAGTATAAGCTT>TCATTTTGTGAAACTGCAAATGGCTCATTAAAACAGTTATAATGTATTTGACAATCAACTCTATATGGATAT>CTGT
gi|41392031|emb|AJ535150.1| Achnanthes bongranii
CTGGTTGATCCTGCCAGTAGTCATACGCTCGTCTCAAAGATTAAGCCATGCATGTCTAAGTATAACTCTT>TTACTTGAAAACTGCGAACGGCTCATTATATCAGTTATAGTTTATTGGATAGTCCCTTACTACTTGGATAA>CCGTA

I tried to get the feature table by using the vsearch plugin, but failed.

So, my question is, how to get the feature table from the FeatureData[Sequence] import? Any other plugin or method exist for feature-table buliding if my import file format is 'FeatureData[Sequence]' ?

Thanks a lot !

5

Sorry I wasn't clear above --- If that file is a QIIME 1-style post-split-libraries output, you should import it as SampleData[Sequences] (as opposed to FeatureData[Sequences], which you showed in a command above). Then, you can use that as input to vsearch dereplicate-sequences and produce a table and rep-seqs. Does that make sense?

7

This topic was automatically closed 31 days after the last reply. New replies are no longer allowed.