Help with using cutadapt

Hello,

I am pretty new to using qiime2 and I am trying to cut some sequences from my reads. For some reason qiime2 pops up with saying that my .fastq.gz file is not a QIIME archive. This is what I entered on the command line:

qiime cutadapt trim-single
--p-adapter GTGCCAGMGCCGCGGTAA
--i-demultiplexed sequences /home/path/to/file/Gh_expt2017_A1_S1_L001_R1.fasta.gz
--output-dir /path/to/output/directory
--verbose

After pressing enter it says that my input file is not a qiime archive.

Thanks in advance for your advise!
Max

Hey there @MAX_MIAO!

That warning is actually for a really good reason - QIIME archives and Artifacts are a core concept in QIIME 2. If you haven't had a chance to at least peek at the docs, now would be the time - you will save yourself a lot of heartache :broken_heart:. I would suggest starting here: Overview of QIIME 2 Plugin Workflows — QIIME 2 2018.6.0 documentation

After you get up to speed there, check out this community tutorial:

Keep on QIIMEin'! :qiime2:

Thanks for the help!

I am trying to import my data and running qiime 2 on a VM. My code is on juypter notebook and having some syntax errors that I am not able to find. It looks like everything is spelled correctly tho.

qiime tools import
--type 'SampleData[PairedEndSequencesWithQuality]'
--input-path /media/sf_Max_Miao/Greenhouse_experiment_2017/test_manifest.csv
--output-path /media/sf_Max_Miao/Greenhouse_experiment_2017/GH_2017_test_seq.qza
--source-format PairedEndFastqManifestPhred33

File "", line 1
qiime tools import --type 'SampleData[PairedEndSequencesWithQuality]' --input-path /media/sf_Max_Miao/Greenhouse_experiment_2017/test_manifest.csv --output-path /media/sf_Max_Miao/Greenhouse_experiment_2017/GH_2017_test_seq.qza --source-format PairedEndFastqManifestPhred33

SyntaxError: invalid syntax

the carrot says indicates a error at 2017 under my output path. I checked if my path was correct and it was and now out of ideas.

Thanks in advance!
Max

Hey there @MAX_MIAO - can you please copy and paste the entire error message you received? You can re-run with the --verbose flag for that info. As well, sharing your manifest file would be helpful. Thanks! :qiime2:

Continuing the discussion from Help with using cutadapt:

Hello,

I was able to figure out my error. I was just having some naming issues on my manifest file, there was a extra intended spacing. Just on another note tho, has this bug been solved yet? Cutadapt thinks my fastq.gz files aren't fastq.gz

because I am also facing the similar issue and now I am resorting to the plan cutadapt tool as you mentioned. My samples have been already demultiplexed for me and each sample has a R1 and R2 read for the forward and reverse reads respectively. And so, this is what I wrote for cutadapt:

cutadapt -a TCCTCCGCTTATTGATATGC --match-read-wildcards /home/qiime2/Greenhouse_experiment_2017/180612_BVDJ2/Gh_expt2017_A10{1,5}_S10{1,5}_L001_R1_001.fastq.gz > /home/qiime2/Greenhouse_experiment_2017/180612_BVDJ2/trimmed_16S/output.fastq

Does this look right? I want the standard output to go into a folder that I already made called "trimmed_16S".

Thanks in advance,
Max

Awesome, thanks for sharing!

Not yet - maybe in the upcoming 2018.8 release (no promises though).

Nothing is jumping out at me, but, I would recommend reviewing the cutadapt docs, to be sure.