Help with using cutadapt

[MAX_MIAO]

Hello,

I am pretty new to using qiime2 and I am trying to cut some sequences from my reads. For some reason qiime2 pops up with saying that my .fastq.gz file is not a QIIME archive. This is what I entered on the command line:

qiime cutadapt trim-single
–p-adapter GTGCCAGMGCCGCGGTAA
–i-demultiplexed sequences /home/path/to/file/Gh_expt2017_A1_S1_L001_R1.fasta.gz
–output-dir /path/to/output/directory
–verbose

After pressing enter it says that my input file is not a qiime archive.

Thanks in advance for your advise!
Max

[thermokarst]

Hey there @MAX_MIAO!

@MAX_MIAO

For some reason qiime2 pops up with saying that my .fastq.gz file is not a QIIME archive.

That warning is actually for a really good reason - QIIME archives and Artifacts are a core concept in QIIME 2. If you haven't had a chance to at least peek at the docs, now would be the time - you will save yourself a lot of heartache . I would suggest starting here: Overview of QIIME 2 Plugin Workflows — QIIME 2 2018.6.0 documentation

After you get up to speed there, check out this community tutorial:

Demultiplexing and Trimming Adapters from Reads with q2-cutadapt

NOTE This tutorial is a work in progress, and is incomplete at the moment. It demonstrates at a high level some of the methods available in the q2-cutadapt plugin available in QIIME 2 2018.2. Please stay tuned here for additional updates as this tutorial is expanded upon in the coming weeks. Multiplexed reads with the barcodes in the sequence reads can be demultiplexed in QIIME 2 using the q2-cutadapt plugin,…

Keep on QIIMEin'!

[MAX_MIAO]

Thanks for the help!

I am trying to import my data and running qiime 2 on a VM. My code is on juypter notebook and having some syntax errors that I am not able to find. It looks like everything is spelled correctly tho.

qiime tools import
–type ‘SampleData[PairedEndSequencesWithQuality]’
–input-path /media/sf_Max_Miao/Greenhouse_experiment_2017/test_manifest.csv
–output-path /media/sf_Max_Miao/Greenhouse_experiment_2017/GH_2017_test_seq.qza
–source-format PairedEndFastqManifestPhred33

File “”, line 1
qiime tools import --type ‘SampleData[PairedEndSequencesWithQuality]’ --input-path /media/sf_Max_Miao/Greenhouse_experiment_2017/test_manifest.csv --output-path /media/sf_Max_Miao/Greenhouse_experiment_2017/GH_2017_test_seq.qza --source-format PairedEndFastqManifestPhred33

SyntaxError: invalid syntax

the carrot says indicates a error at 2017 under my output path. I checked if my path was correct and it was and now out of ideas.

Thanks in advance!
Max

[thermokarst]

Hey there @MAX_MIAO - can you please copy and paste the entire error message you received? You can re-run with the --verbose flag for that info. As well, sharing your manifest file would be helpful. Thanks!

[MAX_MIAO]

Continuing the discussion from Help with using cutadapt:

Hello,

I was able to figure out my error. I was just having some naming issues on my manifest file, there was a extra intended spacing. Just on another note tho, has this bug been solved yet? Cutadapt thinks my fastq.gz files aren't fastq.gz

because I am also facing the similar issue and now I am resorting to the plan cutadapt tool as you mentioned. My samples have been already demultiplexed for me and each sample has a R1 and R2 read for the forward and reverse reads respectively. And so, this is what I wrote for cutadapt:

cutadapt -a TCCTCCGCTTATTGATATGC --match-read-wildcards /home/qiime2/Greenhouse_experiment_2017/180612_BVDJ2/Gh_expt2017_A10{1,5}_S10{1,5}_L001_R1_001.fastq.gz > /home/qiime2/Greenhouse_experiment_2017/180612_BVDJ2/trimmed_16S/output.fastq

Does this look right? I want the standard output to go into a folder that I already made called “trimmed_16S”.

Thanks in advance,
Max

[thermokarst]

@MAX_MIAO

I was able to figure out my error. I was just having some naming issues on my manifest file, there was a extra intended spacing

Awesome, thanks for sharing!

@MAX_MIAO

Just on another note tho, has this bug been solved yet

Not yet - maybe in the upcoming 2018.8 release (no promises though).

@MAX_MIAO

Does this look right?

Nothing is jumping out at me, but, I would recommend reviewing the cutadapt docs, to be sure.