Facing Problem in taxonomic classifier

@Mehrbod_Estaki, Greetings Sir, I follow your all suggestions and i got some good information about my results. now I have some Taxonomic problems i hope you solve these problems

  1. I have told you, sir, i don't have the primers information of the V3-V4 region, and vendor company not respond to my mail, and you told me you can use the generic classifier. which generic classifier i have to use could you please mention in this thread? i don want to go with Greengen so you can suggest me Silva Taxonomy classifier.
  2. one more question should i trained my own RDP based classifier for V3-V4 region?

Hi @Mehrbod_Estaki Sir
i got the primer information from service vendor site.
they send me me forward and reverse primer and adapter information. so now i want to know which tutorial i follow to complete my analysis.
the primer and the adapter information are:

P7 adapter
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
P5 adapter
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

primers

341F
CCTAYGGGRBGCASCAG
806R
GGACTACNNGGGTATCTAAT
here i want to share one thing i have two reads (R1 and R2) for each samples.

Hi @SAMRENDRA01,

I have already answered your original question in another thread very recently:

You have also already asked for this classifer on another post, please avoid cross-posting questions:

And also, the link I provided you earlier to the data-resource page has a note on how to train your own classifier:

Note

Taxonomic classifiers perform best when they are trained based on your specific sample preparation and sequencing parameters, including the primers that were used for amplification and the length of your sequence reads. Therefore in general you should follow the instructions in Training feature classifiers with q2-feature-classifier to train your own taxonomic classifiers (for example, from the marker gene reference databases below).

Please follow the instructions starting there and please be more mindful of your approach in using the forum in the future.

thank you sir @Mehrbod_Estaki
but i am just askig because i am starting qiime 2 i am not a expert but you are in this field. might be i do some mistakes but not deliberately.
i am ending you the primers and adpter information just because when i start my analysis i don't have the primers and adapter information so i choose the pairedend demultiplexed manifest to do my analysis but now service provider send me the information of my primers and adapter information so i just want to know should i do new analysis ( follow new tutorial because i have primers and adapter to trim) or i can go with my previous protocol where i don't cut the adapter from my raw sequence.

Hi @SAMRENDRA01,
I understand that learning microbiome analysis can be a very slow and complex process and we of course welcome all levels of expertise on the forum, and are all for users making mistakes! This is why we continue to provide support to you as well as offer guidance on improving forum etiquette. Please remember that the moderators on this forum are all volunteers and so the more our users follow the forum guidelines, search existing issues on the forum before asking duplicate questions, the more support we can offer to new issues.

If your primers were in your reads before you performed DADA2, then I would say yes, removing them first (using cutadapt) then re-run. If they had been removed previously, either with another tool, or with trim-left option in DADA2 then you don't need to re-run the analysis. As for your feature classifier training step, which is a completely separate thing than your denoising, follow the links above for training your classifier based on your primers.

Thank you @Mehrbod_Estaki
I think i got all the answers from your side. You and your team doing great work to solving problem to every one .... its highly appreciable.
Now one thing stuck in mind is adapter trim. How can we know that our sequences contained the adapter?