Extract reference reads

User Support
1

Hello

When trying to extract reference reads, what's the difference between using the aligned otus seq and non-aligned otus seq.

Thanks

3

Hi @zhang_sonic,
What is the command you are trying to use? qiime feature-classifier extract-reads?

You can only use unaligned sequences with this command.

I hope that helps!

5

Hi Nicholas

Thanks for replying my question. I have few problems here. I was trying to extract-reads using the codes below.

qiime feature-classifier extract-reads \
  --i-sequences 99_otus_non_aligned.qza \
  --p-f-primer GCCTTGCCAGCCCGCTCAGAGAGTTTGATCCTGGCTCAG \
  --p-r-primer GCCTCCCTCGCGCCATCAGNNNNNNNNNNTGCTGCCTCCCGTAGGAGT \
  --p-trunc-len 400 \
  --o-reads 99-ref-seqs.qza

The 99_otus was downloaded from the green tree 13_8 version. But the problem here is I is taking few days and the run still has finished yet, I feel like there must be something wrong with it.

Then I was thinking maybe I will just skip the extract-read part and use the 99_otus_non-aligned.qza to doing the following job. And the second question is how do you think its gonna affect the results?

Thanks for your help

7

See this post. The primer sequences that you are using look like they contain much more than the primers — they also contain linker sequences, perhaps barcode, and other sequences that are non-biological and will not align to your reference. This will cause extraction to fail.

See here

Good luck!