Extract reference reads

Hello

When trying to extract reference reads, what's the difference between using the aligned otus seq and non-aligned otus seq.

Thanks

Hi @zhang_sonic,
What is the command you are trying to use? qiime feature-classifier extract-reads?

You can only use unaligned sequences with this command.

I hope that helps!

Hi Nicholas

Thanks for replying my question. I have few problems here. I was trying to extract-reads using the codes below.

qiime feature-classifier extract-reads \
  --i-sequences 99_otus_non_aligned.qza \
  --p-f-primer GCCTTGCCAGCCCGCTCAGAGAGTTTGATCCTGGCTCAG \
  --p-r-primer GCCTCCCTCGCGCCATCAGNNNNNNNNNNTGCTGCCTCCCGTAGGAGT \
  --p-trunc-len 400 \
  --o-reads 99-ref-seqs.qza 

The 99_otus was downloaded from the green tree 13_8 version. But the problem here is I is taking few days and the run still has finished yet, I feel like there must be something wrong with it.

Then I was thinking maybe I will just skip the extract-read part and use the 99_otus_non-aligned.qza to doing the following job. And the second question is how do you think its gonna affect the results?

Thanks for your help

See this post. The primer sequences that you are using look like they contain much more than the primers — they also contain linker sequences, perhaps barcode, and other sequences that are non-biological and will not align to your reference. This will cause extraction to fail.

See here

Good luck!