Demux error with barcodes

[Dbro]

Hi,
Very new to QIIME too and fairly new to bioinformatics in general
I have some Illumina Sequence data in the form of two sequence files and a seperate barcode file. I've managed to import it following the moving pictures tutorial. I'm trying to demultiplex this data, but I'm having issues with the barcode file, as I keep getting the error saying there was an error uploading the barcodes as metadata. I've copied the first line of each file below. Is anyone able to give me some advice?

Read File 1:

@HWI-M01156:58:000000000-A14TV:1:1101:15941:1367 1:N:0:
TACGTAGGGTGCGGGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTTATTTAAGTGAGGTGTGAAATCCCCGGGCTTAACCTGGGAATTGCATTTCTGACTGGGTAACTTGAGTACTTTTGGGGGGGGTAGAATTCCACGTGTAGCGGTGAAATGCGTAGAGATGTGGGGGAATACCGAAGGCGAAGGCAGCCCCTTGGGATTGTACTGACGCCCTTGTGGGAAAGGGGGGGGGGCAAACG

Read File 2:

@HWI-M01156:58:000000000-A14TV:1:1101:15941:1367 3:N:0:
CCTTTTTTCTCCCCACTCTTTCGCTCTTTTTCTTCTTTTCTTTCCCTTTTTTTTTCCTTCGCCTTCTTTTTTCCTCCTCATCTCTTCGCTTTTCACCGCTNNNCNNNTNNTTCTTCCCCTCTCTTACTTACTCTCTTTTCCCATTCTCCATTTCATTTCCTTGTTTTTCCCCGTTCTTTTCCCTCTTTCCTTTATTTCCCTCCTCCTTCCCCTTTCCCCCCTTTTTTTCCTTTTTTCCTCTCCCCCTTCCT

Barcodes:

@HWI-M01156:58:000000000-A14TV:1:1101:15941:1367 2:N:0:
TTCCGTAGGGTT

Thanks Heaps in advance!

[thermokarst]

Hi @Dbro, sorry to hear things aren’t going well. In order for us to help you, we need some more information:

• What is the version of QIIME 2 you are running?
• What is the exact command (or commands) you are running? Please copy and paste.
• What is the exact error you are experiencing? Please copy and paste the results when run with the --verbose flag.

Thanks!

[Dbro]

Hi thermokarst,

I'm using qiime2-2017.12

the command I'm running and the relevant output appears on the terminal as below:

(qiime2-2017.12) qiime2@qiime2core2017-12:/media/sf_ressci201700019-Paediatric-RespTract-Meta/Vault/Meta-Analysis Data/Not Publicly Available/Melinda/Melinda_Demultiplex_Attempt/Combined_Barcode_Sequence/2013_2/Qiime2_import$ qiime demux em
p-paired --i-seqs 2013_2.qza --m-barcodes-file barcode.fastq --o-per-sample-sequences demux.qza --verbose
There was an issue with loading the file barcode.fastq as metadata:

Thanks a bunch for your help!

[thermokarst]

@Dbro

--m-barcodes-file barcode.fastq

You are supplying the wrong kind of data here - the barcodes file should be your sample metadata file, with a column containing your barcodes. You will also need to add another flag to this command to tell QIIME 2 the name of the column containing your barcodes. Please check out the Moving Pictures tutorial for an example of demultiplexing EMP reads.