Dada2 error with grinder simulated sequence errors

Hi!

I have issue running Dada2 on an artificial in silico dataset of a 10 species mock community. (My aim being to compare those perfect fastq to the actual mixes we made and sequenced v3-v4 on a MiSeq).

I have used a tool named ‘Grinder’ to generate the dataset with the same proportions as the wet-lab mock. The fastq files generated seem good (see file, I made a couple of line counts in bash with my 10 taxa - 10% each mix1):
Results-missing sequences.txt (12.5 KB)

I have successfully generated an abundance table.qza with Deblur (which has its own problems, like the fact that there is only 7 rep-sequences… but that is a matter for another post).

The point is that I have a valid demux.qza but I can’t run Dada2 on it, I get a strange error message that doesn’t really mean much !

The command:

qiime dada2 denoise-single \
   --i-demultiplexed-seqs demux.qza \
   --p-trim-left 0 \
   --p-trunc-len 120 \
   --o-representative-sequences rep-seqs-dada2.qza \
   --o-table table-dada2.qza \
   --o-denoising-stats stats-dada2.qza

(I have tried a couple of variations, like I want my seqs to be 450, but that is the basic config from the moving-pictures tuto; Still gets me the same error message). Also I ran this same command without any trouble on the demux.qza from the moving-pictures with the same qiime environment on the server.

And the error message:

Plugin error from dada2:

  An error was encountered while running DADA2 in R (return code 1), please inspect stdout and stderr to learn more.

Debug info has been saved to /tmp/qiime2-q2cli-err-ds6659vn.log

And the log being refered to:

[[email protected] dada-qiime]$ cat /tmp/qiime2-q2cli-err-ds6659vn.log
Running external command line application(s). This may print messages to stdout and/or stderr.
The command(s) being run are below. These commands cannot be manually re-run as they will depend on temporary files that no longer exist.

Command: run_dada_single.R /tmp/qiime2-archive-u22yyezl/bc2d04d6-d1b0-4261-9519-ae7f07899ffb/data /tmp/tmpj42t3kbl/output.tsv.biom /tmp/tmpj42t3kbl/track.tsv /tmp/tmpj42t3kbl 120 0 2.0 2 Inf consensus 1.0 1 1000000 NULL 16

R version 3.5.1 (2018-07-02) 
Loading required package: Rcpp
DADA2: 1.10.0 / Rcpp: 1.0.2 / RcppParallel: 4.4.3 
1) Filtering ....
2) Learning Error Rates
1.8e+08 total bases in 1500000 reads from 3 samples will be used for learning the error rates.
Error in err[c(1, 6, 11, 16), ] <- 1 : 
  incorrect number of subscripts on matrix
Execution halted
Traceback (most recent call last):
  File "/home/augerjer/.local/easybuild/software/2017/Core/qiime2/2019.7/lib/python3.6/site-packages/q2_dada2/_denoise.py", line 154, in _denoise_single
    run_commands([cmd])
  File "/home/augerjer/.local/easybuild/software/2017/Core/qiime2/2019.7/lib/python3.6/site-packages/q2_dada2/_denoise.py", line 36, in run_commands
    subprocess.run(cmd, check=True)
  File "/home/augerjer/.local/easybuild/software/2017/Core/qiime2/2019.7/lib/python3.6/subprocess.py", line 418, in run
    output=stdout, stderr=stderr)
subprocess.CalledProcessError: Command '['run_dada_single.R', '/tmp/qiime2-archive-u22yyezl/bc2d04d6-d1b0-4261-9519-ae7f07899ffb/data', '/tmp/tmpj42t3kbl/output.tsv.biom', '/tmp/tmpj42t3kbl/track.tsv', '/tmp/tmpj42t3kbl', '120', '0', '2.0', '2', 'Inf', 'consensus', '1.0', '1', '1000000', 'NULL', '16']' returned non-zero exit status 1.

During handling of the above exception, another exception occurred:

Traceback (most recent call last):
  File "/home/augerjer/.local/easybuild/software/2017/Core/qiime2/2019.7/lib/python3.6/site-packages/q2cli/commands.py", line 327, in __call__
    results = action(**arguments)
  File "</home/augerjer/.local/easybuild/software/2017/Core/qiime2/2019.7/lib/python3.6/site-packages/decorator.py:decorator-gen-457>", line 2, in denoise_single
  File "/home/augerjer/.local/easybuild/software/2017/Core/qiime2/2019.7/lib/python3.6/site-packages/qiime2/sdk/action.py", line 240, in bound_callable
    output_types, provenance)
  File "/home/augerjer/.local/easybuild/software/2017/Core/qiime2/2019.7/lib/python3.6/site-packages/qiime2/sdk/action.py", line 383, in _callable_executor_
    output_views = self._callable(**view_args)
  File "/home/augerjer/.local/easybuild/software/2017/Core/qiime2/2019.7/lib/python3.6/site-packages/q2_dada2/_denoise.py", line 189, in denoise_single
    band_size='16')
  File "/home/augerjer/.local/easybuild/software/2017/Core/qiime2/2019.7/lib/python3.6/site-packages/q2_dada2/_denoise.py", line 165, in _denoise_single
    " and stderr to learn more." % e.returncode)
Exception: An error was encountered while running DADA2 in R (return code 1), please inspect stdout and stderr to learn more.

The only thing I can think of now is that, using ‘Grinder’ fastq files generator, I specified quality 30 (well a range from 30 to 10, but they are all q=30 in actuality) and this could cause troubles internally to Dada in its sequencing errors assessment steps. (step “2 Learning Error Rates” in the error message)

Thanks! -JA

Hi @Jeremie_Auger!

Can you tell us a bit more about the execution environment? I ask because this part of the error message jumped out at me:

This usually means that too many threads have been requested, subsequently draining all available memory (I think). Usually we see this error when someone requests a ton of threads, but, in your case, it looks like you stayed with the default of 1, which makes this error a bit troublesome to me.

:qiime2:

Hi Matthew and thanks for the quick response.

I have also been successful at running the same command on the demux.qza from the tutorial on the same server. And indeed, I have tried running with multiple threads at first, but then just wanted to try the simplest version. (Will confirm the the error message is the same. I ran overnight and the log was gone in the morning…)

This is a super-computing cluster named “Compute Canada” and the specific server is Beluga.

[[email protected] test_Dada]$ uname -a
Linux beluga1.int.ets1.calculquebec.ca 3.10.0-1062.9.1.el7.x86_64 #1 SMP Fri Dec 6 15:49:49 UTC 2019 x86_64 GNU/Linux

And more importantly, the conda build of qiime2019.10 didn’t work (I had to migrate there recently). They referred me to a ‘module’ install from an ‘EasyBuild’ package.

eb --rebuild Miniconda3-4.7.10.eb QIIME2-2019.7.eb
module load qiime2/2019.7

And the install instructions are here: https://docs.computecanada.ca/wiki/QIIME

Maybe I will have to refer to the admin of the cluster! Will keep you updated.

In any case, thanks!
Cheers, -JA

And in a sad turn of events, the HPC configuration is not at the source of the problem. I have generated the same error log on my laptop (with a regular conda environment of the latest build, q2019.10). I join a file with the error and the log.
dada2_bug-2020-01-10.txt (4.0 KB)

I am back on the track of a bug because of the evenly-distributed q-scores that might crash the error modelling operations (because of a division by zero or an infinity value or…) .

Will keep the updates coming. Let me know if nay other ideas!

Have a great one, -JA

1 Like

Hi!

After adding some “sequencing errors” to my in silico fastq, I have been able to use Dada2, but only with the parameters that are in the moving pictures tutorial:

qiime dada2 denoise-single \
  --i-demultiplexed-seqs demux.qza \
  --p-trim-left 0 \
  --p-trunc-len 120 \
  --o-representative-sequences rep-seqs-dada2.qza \
  --o-table table-dada2.qza \
  --o-denoising-stats stats-dada2.qza

And if I try to keep any longer for the sequence, I get to the same error as previously described! (even though I know that my fastq contains sequences way longer, median 495nt - see my demux.qzv ). I really have no idea how to fix this. (but at least, Dada2 doesn’t discart representative sequences at is seemingly happens with Deblur).

rep-seqs.qzv (196.2 KB)

Cheers, -Jeremie Auger

Hi @Jeremie_Auger,

This occurs when dada2 encounters artificial quality scores, as you have discovered, and as described here:

How many errors are you inserting and how? What does the quality score distribution look like on your sequences? I strongly suspect dada2 is still failing because you are giving it artificial-looking quality scores, they are still breaking the assumptions of this method.

I think the bottom line is that if you want to use dada2, you need to give it the intended form of data: sequences with at least realistic quality scores.

That is the purpose; deblur identifies sequences that look noisy and throws them away. dada2 does the same if the reads look too noisy, and the fact that you get no sequences filtered out with dada2 is probably a good indication that your quality scores are not “real” enough. The fact that you do not want reads discarded leads me back to my earlier question: do you really want to denoise these data? maybe you do not want to “noise” it to begin with.

EDIT: I see now that you declared the purpose earlier on:

So I don’t think you want to generate noisy data to begin with, if you want to compare the sequenced compositions to the expected compositions. You can just compare the real to the “perfect” composition downstream as a feature table. I have a little example of how to do it in this tutorial (ignore the quirks related to fungi, skip to the part about q2-quality-control and the various methods in there that you can use):

I hope that helps!

1 Like

Hi!

I think that I really like the idea of testing the whole pipeline, from fastq to final graphs, and really compare it to actual data from the MiSeq. And now, I am scared of what Deblur has done! The mock10 community that we used in the lab has a lot of probiotics strains and I did expect some of the to be too close and get merged into one ASV (like Dada2 did, I’ll get back to it).

So for my Deblur run, I extracted the V3-V4 region in silico by using the primer sequence in our in house reference genomes database. I know for a fact that all 10 sequences made it to the .fastq files. But instead or merging sequences into ASV (which could maybe be fixed with parameter tuning…). But instead, all the taxa that made it to the ASV table have the same proportions and same for the taxonomically attributed table. (there is 1 going missing at taxonomic attribution, as 8 are in the rep-seqs, but only 7 in the taxa bar plot.)

So the strange thing it that for Deblur, all reads had perfect q30 for the whole length of the read in the fastq file. And some got ditched before the table.qza (2 out of 10) and one other got ditched during taxonomic attribution. But they all have exactly the same proportion! (14% -> 100% / 7 ).
bar-plot-mock10-Deblur.qzv (326.9 KB)
you can have a look at the first column, the Mix1, which is 10 strains at 10% each.

And it is not the case with Deblur, where (as expected) two lacto strains got merged as one (the Lactobacillus_zea group) and all the others are at 10%. (I still have other issues, but much better still.) But for Dada to accept any artificial fastq, I had to put errors in there (but as the demux.qzv shows, grinder did it in a strange fashion! Probably expecting to make reads more in the 150-250bp range than ~450bp). But have a look at the bar plot from dada too :slight_smile:
bar-plot-mock10-Dada.qzv (321.0 KB)

What would you do? Manually write an abundance table and import it as if it was a featureTable.qza?

(Also, I am trying to keep the Fastq generation step because: I would like to take a swing at 16S copy number correction in the pipeline since we have genomic data for all strains in the mock community. Could be great to make in silico dataset w/ and w/o different 16S copy number and correct or not for it).

Any idea on what you think makes Deblur throw away perfect quality reads from ASV generation? I am willing to share data if you want to reproduce the bugs.

Thanks for the help!
Have a great one, -JA

Yes. If you have expected compositions, I would create an abundance table with those expected compositions. You can adjust for expected differences in 16S copy number manually (e.g., if Mix1 is equal cell proportions but not equal copy #feature-classifier)

I am really not sure. Let’s see if others have any thoughts. One thing to note: deblur does not use those quality scores, so even though your simulated quality scores are “perfect” does not matter for deblur.

1 Like

Hi @Jeremie_Auger,

Would it be possible to share the simulated dataset?

Thanks,
Daniel

Hi Daniel,

Sure thing! I will share the ‘mix1’ fastq, with the errors added (from Grinder’s clunky error generation). The sequences are ~450-500nts
With a google-drive link, as too big a file to send here:

I imported it as a single forward read with command:

qiime tools import \
   --type 'SampleData[SequencesWithQuality]' \
   --input-path manifest.csv \
   --input-format SingleEndFastqManifestPhred33 \
   --output-path demux.qza

qiime demux summarize \
  --i-data demux.qza \
  --o-visualization demux.qzv

And the associated demux.qzv
demux.qzv (271.3 KB)

1 Like

Thank you @Jeremie_Auger!

I just looked back through this thread and am not seeming to find the parameters used with Deblur. Would it be possible to share those as well?

I’m not sure I fully understand how the demux.qzv file relates to the input file – the visualization reports a single sample and 5,000 sequences while the Mock10-Mix1.fastq.gz seems to contain 500,000.

One possible problem here is that the sequence identifiers are not unique (see below). That can lead to unexpected behavior in subsequent tools, and I would not trust the output of any program applied to these data as is. The identifier in FASTQ is technically only the series of characters following the @ up until the first whitespace, and anything after the whitespace is an optional comment or description. The FASTQ parser that I believe is being used on import is the one from scikit-bio, and the FASTQ expectations for that parser can be found here.

$ funzip Mock10-Mix1.fastq.gz | grep "^@" | cut -f 1 -d " " | head
@R0070-58
@R0026-31
@R0179-27
@R0026-31
@R0026-31
@R0215-1
@R0026-31
@R0083-1
@R0215-1
@R0026-31
$ funzip Mock10-Mix1.fastq.gz | grep "^@" | cut -f 1 -d " " | wc -l
  500000
$ funzip Mock10-Mix1.fastq.gz | grep "^@" | cut -f 1 -d " " | sort - | uniq - | wc -l
      10

All the best,
Daniel

1 Like

Hi!
Haha, indeed, I mixed up two runs. My last ‘demux’ had no quality parameter. Here is the command:

grinder -reference_file full16S_UC_Ref_Lallemand.fna -forward_reverse primers-Illumina-V3_V4.fna -length_bias 0 \
    -unidirectional 1 -abundance_file List-txt-mixes/Mock10-Mix1.tsv -base_name Mock10-Mix1 \
    -read_dist 460 -total_reads 5000 -fastq_output 1 -mutation_dist poly4 3e-3 3.3e-8 -qual_levels 30 20 

So only changing this parameter: -total_reads 5000

I made multiple runs and cut on the size to test more rapidly. But import this fastq and you will see a very similar demux.

The deblur was simply done (part of sbatch script):

qiime quality-filter q-score --i-demux demux.qza --o-filtered-sequences demux-filtered.qza --o-filter-stats demux-filter-stats.qza && \
qiime deblur denoise-16S \
  --i-demultiplexed-seqs demux-filtered.qza \
  --p-trim-length 450 \
  --p-jobs-to-start 8 \
  --o-representative-sequences rep-seqs.qza \
  --o-table table.qza \
  --p-sample-stats \
  --o-stats deblur-stats.qza

And was also done locally without multithreading.

And if you add a “sort | uniq -c”, you will be able to confirm that the counts are good.

But I don’t think that it will solve it. Indeed, in that version I have truncated description line to keep only the name of sequence + taxonomy. But I had to use ‘sed’ to remove all the info about the errors generation. Then the names are very unique! For example:

@1 reference=R0215-1 amplicon=368..832 position=1..460 errors=66%T,76%A,90%G,99%C,109%C,117%T,137+G,138%A,142+T,149%T,150%T,158%C,158+G,159%C,163%T,164%T,167%G,170%T,171%G,173%T,173%G,173-,175%C,176%G,179%G,181%T,181+G,182%G,185%G,187%T,188-,190%T,193%C,193%G,194+A,196%G,197%C,198%C,198%C,207%C,207%G,208%T,208%A,209%A,210-,210-,212%A,212+A,213%C,213%T,214-,214-,218-,218+G,219%T,220%G,221-,225%G,226%A,227%A,228%T,228%A,231%A,231-,231+C,232%G,232%C,232%T,233%T,233-,233-,234+G,235%A,235%A,235-,235+G,236%G,236-,237%T,238%C,238-,239%A,239+C,240%G,240+A,241%A,241%C,241+C,242%A,243%C,244%A,245%C,246%T,246%A,247%T,247%T,247-,248-,248-,249%G,249%G,249%A,249+A,250%C,251%A,252%G,252%G,252%G,253%G,253%C,254%C,255%T,255-,256%C,256+T,257%C,258%A,259%T,260%C,260%A,261%C,261%T,262%T,262%C,262%T,263%A,263%G,263-,265%A,265-,266%A,266%A,266%T,267%T,267%C,267-,267-,268+G,269%G,269%G,269%C,270%T,270+C,271%G,271%T,272%G,273+G,275%A,275%T,275%A,275%G,276%C,276%C,276+A,277%C,277%A,277%T,277%C,277-,278%T,279%C,279%G,280%G,281%T,282%G,282%T,282%C,282+T,282+T,282+A,283%T,283%A,283%A,283+C,284%T,284-,285%C,285%C,285+G,286%C,286%C,286%G,287%T,287%T,287%T,288%A,288%A,288%A,288-,288-,288-,289%T,289%G,290%C,290%T,290%T,290%T,290-,291%T,291%T,291%C,291%C,291%A,291%A,291%A,291-,291+G,292%A,292%A,292%G,292%G,292+T,293%C,293%A,293%A,293%T,293%C,293%T,293+G,294%T,294%A,295%T,295%T,295%C,295%G,295%G,295%T,295+C,295+G,296%C,296%C,296%C,297%G,297%A,297%T,297%A,297-,297+A,298%T,298%A,298-,298+A,299%T,300%C,300%G,300%C,300+T,301%C,301%G,301%G,301%C,301%C,301-,302%G,303%T,303%T,303%T,303-,304%A,304-,305%A,305%A,305%T,305%T,305-,305+A,306%A,306%T,306%C,306%A,306%T,307%T,307%A,307%A,307%A,308%C,308%G,308%C,308%T,308-,309%T,309%T,309%G,309%G,309%G,309%T,309-,309-,310%G,310%G,310%C,310-,311%A,311%T,311%G,311%A,311-,312-,312-,313%G,313%G,313-,314%T,315%T,315%C,315%G,315%C,315%G,315-,316%T,316%C,316%T,316%T,316%A,316-,317%C,317%C,317%C,317%G,317%C,317%A,317%G,317%A,317%C,317-,318%T,318%C,319%G,319%A,319%T,319+G,320%C,320%G,320%T,320%T,320%C,320-,320-,320+T,321%C,321%T,321%A,321%T,321%C,321+A,322%G,322%C,322%G,322%C,323%C,323%C,323%T,323+C,324%T,324%C,324%T,324%C,324%C,324%C,324+A,325%G,326%C,326%A,326%T,326%A,326%A,326-,327%T,327%T,327%C,327%C,327%A,327+T,328%C,328%C,328%T,328%T,328%G,328%C,329%A,329%A,329%A,329%A,329%G,329%G,329%G,330%T,330%G,330%G,330%C,330%C,330%C,330%T,330%G,330%T,330%G,331%T,331%A,331-,332%G,332%A,332%G,332%C,332%G,332-,333%A,333%C,333%C,333%A,333%T,334%T,334%A,334%T,335%G,335-,336%C,336%C,336%C,336%T,336+G,337%T,337%G,337%A,337+T,338%A,338%A,338%C,338%C,338+G,339%G,339%T,339%T,339%G,339%A,339%A,339%A,339%T,339%T,339%A,339%T,339%A,340%A,340%A,340%A,340%G,340%G,340+T,341%T,341%G,341%G,341%C,341%C,341%T,341%T,341%T,341%C,341-,341-,341+T,342%A,342%C,342%C,342%A,342%A,342%A,342+A,343%A,343%C,343%T,343-,343+C,343+C,344%C,344%A,344%C,344%G,344%C,344-,344-,344+G,345%T,345%A,345%C,345%C,345%A,345%T,345+C,345+G,346%A,346%A,346%G,346%G,346%A,346%C,346%A,346+A,347%C,347%C,347%G,347-,348%T,348%C,348%A,348%C,348-,349%T,349%T,349%G,349%G,349-,349+G,350%A,350%C,350%T,350%A,350%T,350%A,350+C,351%T,351%T,351%T,351%C,351-,352%C,352%G,352%G,352%C,353%A,353%A,353%C,353%C,353%C,353%C,353%T,353%C,353-,353+T,353+G,354%T,354%C,354%T,354%T,354%T,354%T,354%T,354%C,354+T,355%C,355%C,355%T,355%C,355%T,355%G,355%G,355%G,355%G,355%G,355-,355+G,355+C,356%C,356%G,356%T,356%C,356%T,356%C,356%C,356%C,356-,357%C,357%C,357%G,357%G,357%C,357%C,357%C,357-,357-,357-,357-,357+T,357+G,358%T,358%C,358%T,358%C,358%T,358%T,358%C,358%T,358-,358+A,359%G,359%A,359%T,359%A,359%A,359%A,359%A,359%A,359-,359+A,360%T,360%T,360%T,360-,361%A,361%C,361%C,361%G,361%A,361+A,362%C,362%C,362%T,362-,362-,363%A,363%A,363%C,363%C,364%G,364%T,364%C,364%C,364%T,364%G,364%C,364+A,365%G,365%A,365%C,365%G,365%G,365%C,365%C,365%G,365%A,365%G,365-,365-,365+G,366%G,366%G,366%G,366%T,366%C,366%G,366%G,366%C,366+G,367%G,367%A,367%C,367%G,367%G,367%G,367%A,367%C,367-,367+T,367+G,368%G,368%G,368%T,368%G,368%T,368%G,368%G,368%G,368%G,368%T,368+G,368+C,369%A,369%A,369%A,369%A,369%G,369%G,369%G,369%G,369+T,370%A,370%T,370%C,370%C,370%A,370-,371%A,371%T,371%C,371%C,371%A,371%C,371%C,371%A,371%A,371%A,371-,372%G,372%C,372%C,372%C,372%G,372%G,372%T,372%G,373%C,373%T,373%C,373%T,373%C,373%G,373%C,373%T,373%C,373%G,373%G,373-,373+A,374%C,374%C,374%A,374%A,374%T,374-,374-,374-,374+G,375%C,375%C,375%C,375%T,375%C,375%C,375%G,375%T,375-,375-,375-,375+C,376%C,376%T,376%T,376%G,376%T,376%T,376%T,376%T,376%T,376%G,376%G,376%C,376-,377%A,377%G,377%A,377%T,377%T,377%T,377%G,377%A,377%G,377%A,377+A,378%G,378%C,378%G,378%C,378%T,378%G,378%C,378%C,378%C,378+G,378+C,379%G,379%T,379%A,379%T,379%T,379-,379+G,379+G,380%T,380%G,380%A,380%A,380%A,380%T,380%G,380%T,380%A,380%A,380+G,380+C,380+G,380+A,381%G,381%T,381%T,381%G,381%G,381%T,381%C,381%C,381-,381-,381+G,381+C,382%A,382%T,382%A,382%C,382%A,382+G,382+T,382+C,383%A,383%C,383%A,383%C,383%G,383%A,383-,383-,383-,384%C,384%A,384%C,384%T,384%T,384%A,384%T,384%T,384%T,384-,384-,384+T,385%A,385%C,385%T,385%T,385%T,385%A,385%A,385%T,385%T,385-,386%A,386%A,386%G,386%T,386%A,386%A,386%T,386%G,386%A,386%T,386%G,387%T,387%A,387%A,387%T,387%T,387%C,387%A,387%C,387%T,387%C,387%A,387%T,387-,387-,387-,387+C,387+C,387+T,388%T,388%G,388%T,388%C,388%G,388%G,388%T,388%T,389%T,389%G,389%T,389%C,389%C,389%T,389%G,389%C,389%G,389%T,389%G,389%T,389%T,389-,389-,389+A,390%C,390%T,390%A,390%A,390%C,390%C,390%C,391%T,391%A,391%T,391%T,391%C,391%T,391%T,391%C,391%A,391-,391+C,392%G,392%A,392%A,392%A,392%A,392%A,393%T,393%T,393%A,393%A,393%C,393%A,393%C,393%A,393%T,393%C,393%C,393%C,393%C,393%A,393%C,393%A,393-,394%A,394%C,394%A,394%T,394%A,394%T,394%T,394%A,394%C,394-,394-,394+T,395%A,395%A,395%T,395%A,395%T,395%A,395%T,395%G,395%T,396%G,396%G,396%A,396%C,396%A,396%C,396%A,396%C,396%C,396%G,396%G,396%C,396-,397%C,397%T,397%T,397%T,397%T,397%T,397%C,397%T,397%C,397%C,397%T,397+C,398%G,398%A,398%A,398%C,398%A,398%A,398%G,398%A,398%G,398%A,398%A,398%C,398%G,398-,398+G,398+T,398+G,398+A,399%G,399%T,399%T,399%T,399%G,399%T,399%A,399%A,399%G,399%A,399%A,399%T,399%A,399%A,399-,399+G,399+G,400%G,400%A,400%C,400%G,400%C,400%C,400%C,400%G,400-,400-,400-,400-,400+C,400+C,401%A,401%A,401%A,401%C,401%A,401%A,401%T,401%C,401%A,402%A,402%C,402%C,402%C,402%T,402%T,402%A,402-,402-,402+A,402+G,403%C,403%C,403%G,403%G,403%A,403%G,403%C,403%G,403%G,403+T,404%G,404%G,404%T,404%T,404%A,404%T,404%T,404-,404-,404+A,404+T,405%A,405%C,405%G,405%C,405%A,405%G,405%A,405%G,405%C,405%C,405%C,405%G,405-,405-,405+T,406%T,406%T,406%C,406%C,406%A,406%T,406%A,406%T,406%T,406%T,406%C,406%A,406%C,406-,406-,407%C,407%G,407%C,407%A,407%G,407%G,407%C,407%G,407%C,407%G,407+C,407+A,408%T,408%T,408%C,408%T,408%C,408%T,408%G,408%C,408%T,408+A,409%C,409%T,409%T,409%G,409%T,409%G,409%T,409%T,410%T,410%T,410%T,410%T,410%A,410%G,410%A,410%A,410%T,410+A,411%G,411%G,411%G,411%C,411%G,411%A,411%C,411%G,411%C,411%A,411%G,411%C,411-,411-,411+C,411+T,412%A,412%C,412%C,412%C,412%C,412%C,412%A,412%A,412%C,412%C,412%T,412%A,412%T,412-,412-,412-,412+T,413%G,413%T,413%T,413%T,413%G,413%T,413-,413-,413+G,414%A,414%A,414%A,414%G,414%A,414%G,414%A,414%G,414%A,414%A,414%A,414%A,414%A,414%G,414%A,414%A,414-,414-,414+A,414+G,414+C,415%T,415%A,415%T,415%C,415%C,415%A,415%T,415%C,415%A,415%A,415%A,415%A,415%C,415%C,415%C,415%C,415-,415-,415+C,415+A,416%T,416%G,416%A,416%A,416%A,416%A,416%T,416%A,416%A,416%G,416%G,416%T,417%C,417%G,417%G,417%C,417%C,417%G,417%A,417%A,417%G,417%C,417%A,417%A,417%G,417+A,417+C,417+T,418%C,418%A,418%C,418%C,418%A,418%C,418%A,418%A,418%C,418%A,418%C,418%T,418%T,418+A,418+C,419%C,419%G,419%C,419%T,419%G,419%T,419%G,419%G,419%G,419%G,419-,420%T,420%C,420%A,420%A,420%C,420%A,420%C,420%T,420%A,420%T,420%T,420%T,420%A,420-,420-,420-,420-,420-,421%T,421%T,421%C,421%T,421%C,421%T,421%A,421%T,421%T,421%A,421%T,421%C,421%A,421%A,421-,421+A,422%A,422%A,422%A,422%T,422%G,422%G,422%A,422%G,422%A,422%T,422%G,422%A,422%A,422%T,422%G,422%G,422-,422+C,422+A,423%A,423%G,423%G,423%G,423%G,423%G,423%C,423%C,423%A,423%G,423%A,423%G,423-,423+C,423+G,424%A,424%T,424%T,424%T,424%A,424%T,424%A,424%T,424%A,424%A,424%T,424%T,424%G,424%G,424%T,424%A,424-,424-,425%C,425%T,425%T,425%C,425%C,425%T,425%C,425%A,425%C,425%A,425%C,425-,425-,425+T,425+A,425+T,425+A,426%C,426%C,426%G,426%G,426%C,426%T,426%C,426%G,426%C,426%T,426%T,426%T,426%C,426%C,426-,426-,426-,427%G,427%C,427%T,427%G,427%G,427%G,427%T,427%C,427%T,427%C,427%C,427%G,427%T,427%C,427%G,427-,427-,427-,427-,427+T,427+T,427+T,427+C,427+C,428%T,428%G,428%C,428%G,428%C,428%G,428%C,428%C,428%C,428%C,428%G,428%G,428%T,428%T,428%G,428+T,428+G,429%T,429%T,429%A,429%T,429%C,429%C,429%A,429%T,429%A,429%C,429%A,429%C,429%T,429-,429-,429-,429+A,430%T,430%G,430%A,430%T,430%G,430%A,430%G,430%T,430%T,430%A,430%T,430%G,430%A,430%G,430%A,430%G,430-,430-,430-,430+T,430+T,431%G,431%C,431%C,431%G,431%C,431%C,431%T,431%G,431%G,431%T,431%G,431%G,431%G,431%C,431%G,431%G,431-,431+A,432%C,432%A,432%A,432%A,432%G,432%G,432%A,432%A,432%C,432%G,432%G,432%C,432%C,432%A,432%G,432%A,432%G,432%G,432-,432+G,433%T,433%C,433%T,433%C,433%C,433%C,433%T,433%T,433%T,433%C,433%C,433%A,433%C,433%T,433%A,433%C,433%C,433-,433-,433-,433-,434%T,434%A,434%C,434%T,434%C,434%C,434%C,434%A,434%A,434%A,434+G,434+T,435%C,435%C,435%A,435%C,435%T,435%C,435%C,435%A,435%A,435%A,435%C,435%A,435%A,435%A,435-,435-,435-,435-,435-,435+C,435+G,436%A,436%A,436%C,436%C,436%C,436%A,436%A,436%C,436%C,436%G,436%G,436%A,436%C,436%C,436%G,436%G,436%C,436%C,436%A,436-,436+A,436+C,436+A,437%G,437%T,437%C,437%T,437%T,437%T,437%T,437%C,437%C,437%C,437%G,437%C,437%T,437%T,437%G,437+G,438%C,438%A,438%T,438%A,438%C,438%T,438%C,438%A,438%A,438%T,438%C,438%C,438-,438+A,438+A,439%A,439%T,439%T,439%A,439%G,439%G,439%G,439%A,439%A,439%A,439%G,439%A,439%G,439%T,439%A,439%A,439%A,439%A,439%T,439%G,439-,439+G,439+C,439+G,439+A,440%T,440%C,440%C,440%T,440%A,440%A,440%T,440%C,440%A,440%T,440%C,440%T,440-,440+A,440+T,440+G,441%C,441%T,441%T,441%T,441%T,441%G,441%T,441%C,441%C,441%C,441%G,441%G,441%T,441%C,441%G,441%C,441%C,441%G,441%G,442%G,442%C,442%C,442%T,442%C,442%G,442%G,442%G,442%T,442%T,442%G,442%G,442%G,442%C,442%G,442%C,442%T,442%C,442%T,442-,442+G,442+A,442+C,442+A,443%T,443%A,443%G,443%T,443%A,443%G,443%G,443%T,443%T,443%T,443%A,443%G,443%A,443%A,443%A,443%T,443-,443-,443+A,444%G,444%G,444%T,444%G,444%C,444%T,444%T,444%G,444%T,444%T,444%T,444%C,444%T,444%G,444%T,444%T,444%G,444%G,444-,444-,444+G,445%T,445%T,445%A,445%A,445%C,445%C,445%T,445%T,445%C,445%C,445%A,445%T,445%A,445%C,445%C,445%A,445%T,445%T,445%T,445-,445-,445+T,445+A,446%T,446%T,446%A,446%T,446%A,446%C,446%C,446%C,446%C,446%A,446%T,446%C,446%A,446%A,446-,446-,446-,446+G,447%T,447%C,447%G,447%G,447%C,447%G,447%T,447%T,447%T,447%G,447%T,447%T,447%C,447%G,447%T,447%G,447%G,447%T,447%T,447%C,447%G,447%T,447-,447-,447-,447-,447+A,447+G,448%G,448%G,448%C,448%A,448%A,448%A,448%A,448%G,448%A,448%C,448%A,448%G,448%C,448%C,448%G,448%G,448%G,448%G,448-,448+T,448+G,448+T,448+C,449%A,449%A,449%C,449%G,449%A,449%C,449%A,449%C,449%A,449%C,449%C,449%G,449%G,449%G,449%A,449%C,449%G,449%A,449%G,449%G,449%A,449%C,449%G,449-,449+G,449+T,449+G,450%T,450%G,450%T,450%G,450%G,450%T,450%C,450%C,450%C,450%G,450%T,450%C,450%G,450%T,450%G,450-,450+T,451%A,451%C,451%A,451%T,451%T,451%A,451%C,451%T,451%A,451%C,451%C,451%C,451%C,451%A,451%C,451%T,451-,451+C,451+T,451+C,452%C,452%G,452%C,452%T,452%C,452%G,452%C,452%G,452%C,452%C,452%T,452%G,452%T,452%T,452%T,452%T,452%G,452%C,452%T,452-,452-,452-,452-,452-,452+A,452+A,452+C,453%C,453%C,453%G,453%C,453%A,453%A,453%G,453%A,453%A,453%A,453%A,453-,453-,453+C,453+A,453+C,454%G,454%C,454%G,454%G,454%C,454%G,454%T,454%T,454%C,454%T,454%T,454%T,454%T,454%G,454%T,454%C,454%C,454%C,454%G,454%C,454%G,454%T,454%C,454%G,454%C,454%C,454%C,454%G,454-,454-,454+T,455%G,455%A,455%A,455%G,455%A,455%T,455%T,455%G,455%A,455%T,455%G,455%G,455%G,455%T,455-,455-,455-,455+T,455+G,456%T,456%T,456%G,456%G,456%G,456%G,456%T,456%A,456%G,456%A,456%A,456%T,456%A,456%G,456%G,456-,456+G,457%G,457%T,457%A,457%T,457%G,457%T,457%A,457%G,457%T,457%T,457%G,457%G,457%T,457%A,457%A,457%A,457-,457+C,457+A,457+T,458%A,458%C,458%C,458%C,458%A,458%C,458%C,458%G,458%A,458%A,458%C,458%A,458-,458+A,458+A,459%A,459%T,459%C,459%C,459%C,459%C,459%T,459%C,459%T,459%T,459%A,459%C,459%A,459%A,459%A,459%T,459%T,459-,459-,459-,459+A,459+G,459+G,459+T,460%C,460%T,460%T,460%C,460%T,460%C,460%T,460%A,460%C,460%T,460%T,460%C,460%C,460%C,460%A,460%A,460%A,460-,460+A,460+T description="K_Bacteria; P_Firmicutes; C_Bacilli; O_Lactobacillales; F_Lactobacillaceae; G_Lactobacillus; S_Lactobacillus casei."
CCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGATGGAGCAACGCCGCGTTAGTGAAGAAAGCTTTCGGGTCGTGAAACTCTGCTGTTGGAGACGAATGGTTGGCAGAGTAACTGTTGTCGGGAGTGATCGGTATTTAACCAGACGCGCCTTGGGTATGTCCGGCGATGGAGGCTGTTAGTAAGCCAGGTGGCAGAATAATCCGGTGTATGAAACGCTAGGTACGACCACACAAACAGCCCTCATATTGTAGCTCTGCGTGCATGGTCTTAACCGGTGGGTTGATCGCAATCTGATATCTGTCACTCCAGATCGGTTTGATCGAGTTAACCGTCGAAGACCTGCTGCTGAAAACCAGCGTGTGCGTGAGCAACGCGGAGCGAGCAGTCTGCCTTACCATTTCGTGAGGCCAAGGTATTGCATATTACTTGAGCCATGACTTACACACGTATATTTCCGTGATTAGAGTCGACAGGAAGCGAATGGGACAAGTAGAGTGTCGTGTCTCAACCACTTGGCATAAAGGTAT
+
?????????????????????????????????????????????????????????????????0?????????0?????????????0????????0?????????0???????0????????????????????00????0??????00???????000???00??0??00??00??0?000??0?0?0??0?0?000????????000?000???000???0000??00?00000000000000000000000000000?0?000000?0?0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
@2 reference=R1001-10 amplicon=368..832 position=1..460 errors=95+G,123%C,133%T,140%G,141%T,143-,157%C,159%T,159%C,164%G,171%A,172+G,175%A,175%A,184%A,185%A,189%A,189%T,197+A,198%C,198-,203%T,207-,209%G,210%T,210%C,211%G,211%A,211%G,213%C,214%C,215%A,220%A,220%A,222%C,222%A,222+T,223%T,223%C,223+C,225%A,225%A,226%T,226%A,228%A,230%A,231+A,233-,234%T,234%T,235%C,236%T,236+A,237%T,237+A,238%T,238%C,239%T,240%G,240%G,240%G,241%C,241%A,241+G,242%A,242%G,242-,242+A,243%T,245%A,245+C,246%T,248%T,248%A,249%C,249%G,249+G,250%A,252%C,252-,253%C,253-,255%T,255%G,255+A,255+A,256%T,256%T,257%C,257%C,257+T,258%A,258+A,259%T,259%A,259%T,260+A,261%T,261%T,262%G,262+C,262+G,263%A,263%C,263%G,264%A,264%T,264%C,266%T,266%T,266%T,267%C,268%T,268%C,269%C,270%T,270%A,270%T,270%T,270-,271%G,271+T,272%A,272%A,274%A,274%G,275%T,275%G,276%C,276%A,276%C,277%A,277%A,277+A,278%A,279%A,280%T,280%G,281%T,282%C,282%T,283%A,284%A,284%T,284%A,284%A,284%G,285%T,285%T,285+A,286%C,286%G,286%G,286%C,286%T,286+G,286+A,287%T,287%T,287%C,287%G,287%G,287+C,288%A,289%C,290%C,290%T,290%C,290-,290-,291%A,291%A,291%T,291%T,291-,293%T,293%C,293+C,294%T,294%G,294%T,294-,295%C,295%G,295-,295+G,296%C,296%G,296%G,296%C,296%C,297%A,297%A,297%G,297%A,297%C,297%G,297-,297+T,298%C,298%A,298%T,299%T,299%C,299-,300%C,300+G,300+C,302%T,302+C,302+A,303%T,303+C,304%C,304%C,304%A,305%C,305%T,305-,305-,305+G,306%T,306%T,306%A,306%T,307%C,307%C,307-,307+C,308%G,308%C,308%T,308%G,308%G,308%T,308%C,308-,308-,309%C,309%A,309%T,309%A,310%G,310%T,310+C,311%G,311%A,312%A,312%G,312%G,312%A,312%G,312%A,312%C,312+G,313%C,313%C,314%T,314%T,316%C,316%C,316%C,316%T,316%T,316%A,317%G,317%G,317%A,318%T,318%C,319%G,319%G,319%T,320%T,320%C,320%G,320%T,320%G,320%C,321%T,321%T,321%A,321-,321-,322%G,322%C,322%C,322%T,323%T,323%G,323-,324%C,324-,324-,324-,325%C,325%T,325%T,325%T,325%C,325%C,325%G,325%G,325%T,325%C,326%T,326%C,326%T,326%A,326%A,326%A,327%T,327%C,327%T,327%C,328%T,328%T,328%G,328%C,328+T,329%A,329%G,329%G,330%C,330%T,330%C,330%C,330%T,330%T,330%C,330%T,331%T,331%C,331%C,331+A,331+T,332%A,332%G,332%A,332%C,332-,333%T,333%T,333-,334%A,334%C,334%T,334%A,334%T,334%T,334+T,334+T,335%C,335%G,335%C,336%C,336%C,336%G,336%G,336%G,337%A,337%A,337%A,337-,337-,337+G,338+T,339%T,339%A,339%G,339%G,339%G,340%A,340%A,340%A,340%A,340%T,340-,341%T,341-,341+T,342%A,342-,343%T,343%A,343%C,343%A,343+A,344%A,344%C,344%A,344%C,344%A,344+G,345%A,345%C,346%C,346%C,346%G,346%A,346%A,347%C,347%G,347%C,347%G,347-,347-,348%T,348%T,348%T,348%T,348%T,348%C,348%C,348-,349%G,349%A,349%T,349%A,349%A,349%A,349%G,349%A,349+G,349+C,350%T,350%A,350%T,350-,351%C,351%T,351%T,351%T,351%T,351%A,351-,351-,352%G,352%A,352%G,352%C,352%G,352+A,352+C,353%C,353%A,353%A,353%C,353%T,353%A,353%A,353+C,354%C,355%T,355%C,355%G,355%T,355%C,355%G,355-,355+T,356%G,356%T,356%T,356%T,356%G,356-,357%C,357+A,358%A,358%C,358%C,358%C,358%A,358+T,359%T,359%G,359%G,359-,359+T,359+G,360%A,360%A,361%C,361%C,361%G,361%A,361%G,361-,362%G,362%T,362%T,362%G,362%G,362%T,362+T,363%T,363%C,363%T,363%A,363%C,363+G,364%G,364%C,364%C,364%C,364%G,364-,364+C,365%G,365%C,365-,366%T,366%G,366%G,366%G,366%G,367%G,367%G,367%C,367%A,367+T,368%C,368%T,369%A,369%C,369%C,369-,369+G,369+C,370%C,370%T,370%T,370%C,370%C,370%T,370-,371%C,371%T,371%A,371%T,371+C,371+T,372%G,372%C,372%G,372%T,372%C,372%T,373%G,373%C,373%T,373%T,373%C,374%T,374%A,374%T,374%C,374-,375%G,375%C,375%T,375-,375+T,376%T,376%T,376%G,376%T,376%G,376-,376-,376+C,377%A,377%A,377%T,377%T,377%T,378%T,378%T,378%C,378%T,378%C,378-,378+C,378+G,379%G,379%A,379%T,379%T,379%T,379%A,379+C,380%G,380%T,380%G,380%A,380%A,380%A,380%A,380%A,381%T,381%T,381%C,381%T,381%G,381%T,381%G,381%T,381-,382%T,382%C,382%T,382-,383%A,383%G,383%G,383%C,383%G,383%C,383%C,383%A,383%G,383-,383-,383-,384%A,384%C,384%C,384%A,384%C,384-,384-,384-,384-,384-,385%A,385%T,385%T,385%T,385-,385-,386%A,386%A,386%T,386%A,386-,387%A,387%A,387%A,387%A,387%C,387%C,387%C,387%C,387%T,387%T,387%C,387+A,388%G,388%T,388%C,388%C,388-,389%C,389%C,389%G,389%C,389%G,389-,389+T,389+C,390%C,390%T,390%C,390%T,390%T,390%C,390%C,390%A,390%C,390+T,390+G,391%C,391%A,391%T,391%C,391%A,391%T,391%T,391%C,391%C,391-,391+A,392%T,392%T,392%A,392%A,392%G,392-,392-,393%T,393%C,393%T,393%C,393%T,393%C,393%C,393%A,393%C,393%A,393%T,393-,393-,393+C,393+A,394%C,394%T,395%T,395%A,395%T,395%T,395%T,395%T,395%A,395%A,395%T,395%A,395%G,395%A,395+C,396%C,396%A,396-,396+C,397%A,397%T,397%C,397%A,397%A,397%A,397%T,397%T,397-,397+T,398%A,398%G,398%A,398-,398-,399%G,399%T,399%A,399%A,399%G,399%T,399%T,399%T,400%C,400%G,400%C,400%G,400%G,400%G,400-,401%T,401%T,401%A,401%C,401%C,401%A,401%A,401%C,401%T,401-,401-,401-,402%A,402%T,402%A,402%C,402%T,402%C,402%A,402-,402-,402+T,402+A,403%G,403%A,403%G,403%G,403%A,403%C,403%C,403%A,403-,403-,403+T,404%T,404%G,404%T,404%G,404%A,404-,404+T,404+A,404+T,404+C,405%C,405%A,405%C,405%C,405%C,405%C,405%A,405%G,405%G,405%C,405-,405+G,406%C,406%T,406%C,406%A,406%T,406%T,406+T,407%G,407%A,407%G,407%A,407%C,408%G,408%G,408%C,408%G,409%C,409%G,409%T,409%T,409%G,409%G,409%T,410%T,410%A,410%A,410%G,410%G,410%G,410%T,410%G,410-,411%G,411%A,411%C,411%G,411%G,411%A,411%G,411%C,411%A,411-,411-,411+T,411+C,412%T,412%A,412%C,412%T,412%C,412%C,412%C,412%C,412%T,412%A,412-,413%C,413%C,413%T,413%C,413%G,413%T,414%T,414%G,414%A,414%A,414%A,414%A,414%T,414%T,414-,415%C,415%C,415%C,415%C,415%A,415%T,415%T,415%T,415%A,415%C,415-,415-,415+C,416%A,416%A,416%A,416%G,416%G,416%T,416+A,417%A,417%A,417%A,417%C,417%G,417%C,417+T,418%C,418%T,418%A,418%C,418%C,418%T,418%C,418%C,418%C,418%T,418%T,418%A,418%C,418-,418-,418-,418-,419%G,419%C,419%T,419%T,419%T,419%T,419%T,419%G,419%C,419%C,419%G,419%C,419%T,419%C,419%G,419%C,419-,420%A,420%T,420%T,420%A,420%A,420%C,420%T,420%A,420%A,420%A,420%C,420%T,420%C,420-,420+A,420+C,421%T,421%T,421%C,421%C,421%T,421%T,421%T,421%C,421%C,421%A,421%T,421-,421-,421+G,421+G,422%A,422%A,422%T,422%A,422-,422-,422-,422+C,423%A,423%C,423%A,423%A,423%A,423%C,423%C,423%A,423%G,423%C,423%C,424%G,424%G,424%A,424%T,424%T,424%T,424%A,424%A,424%G,424%T,424%T,424%A,424-,425%A,425%T,425%C,425%C,425%T,425%C,425%C,425%T,425%T,425%A,425-,425-,425+G,426%G,426%C,426%T,426%T,426%G,426%C,426%G,426%C,426%G,426%G,426%C,426+C,427%G,427%G,427%G,427%C,427%C,427%T,427%C,427%G,427%C,427%G,427%C,427%G,427%G,427%C,427%T,427%G,427%T,427%T,427+T,428%G,428%G,428%T,428%G,428%T,428%T,428%T,428-,428+T,428+G,428+A,429%C,429%A,429%C,429%T,429%T,429%A,429%C,429%T,429+G,429+G,430%G,430%A,430%A,430%A,430%T,430%G,430%A,430%A,430%G,430-,430-,430+C,431%T,431%T,431%C,431%C,431%G,431%C,431-,431-,431-,431+G,431+T,431+C,432%C,432%G,432%C,432%A,432%A,432%G,432%C,432%G,432%A,432%C,432%G,432%G,432+C,433%C,433%C,433%C,433%C,433%T,433%T,433%T,433%C,433%T,433%A,433+T,434%A,434%T,434%T,434%T,434%C,434%C,434%C,434%C,434%T,434%T,434%A,434-,434-,434+C,434+G,434+T,435%C,435%C,435%A,435%T,435%C,435%C,435%T,435%T,435%C,435%C,435+G,436%C,436%A,436%C,436%C,436%A,436%C,436%G,436%C,436%C,436+A,436+A,436+G,437%C,437%T,437%C,437%C,437%G,437%G,437%T,437%C,437%C,437%C,437%C,437%G,437-,437+A,437+T,438%A,438%C,438%C,438%A,438%T,438%A,438%A,438%C,438-,439%A,439%T,439%T,439%G,439%G,439%A,439%T,439%T,439%T,439%A,439%G,439%T,439%G,439%T,439%T,439%G,439%T,439%G,439%G,439-,439-,439-,439+C,439+T,439+T,440%T,440%T,440%T,440%A,440%C,440%T,440%A,440%C,440%T,440%C,440%A,440%C,440%C,440%A,440-,440-,440+T,440+A,441%T,441%T,441%T,441%G,441%G,441%C,441%C,441%C,441%G,441+G,442%T,442%G,442%G,442%C,442%G,442%T,442%T,442%T,442%T,442%G,442%T,442%G,442+G,442+G,443%G,443%T,443%T,443%A,443%A,443%T,443%T,443%G,443-,443+T,444%C,444%C,444%T,444%T,444%T,444%G,444%T,444%T,444%G,444%G,444%G,444-,444+A,444+A,445%A,445%C,445%A,445%T,445%A,445%C,445%T,445%C,445%C,445-,445-,445+A,446%C,446%C,446%T,446%C,446%T,446%C,446%T,446%A,446%T,446%C,446%T,446%C,446%A,446%A,446%A,446-,446-,446+A,447%C,447%G,447%G,447%G,447%C,447%T,447%G,447%G,447%C,447-,447-,447+A,448%C,448%A,448%C,448%C,448%C,448%G,448%G,448%C,448%A,448%C,448%G,448-,448+G,448+A,449%G,449%G,449%G,449%G,449%G,449%G,449%C,449%C,449%G,449%A,449-,449+C,450%C,450%G,450%C,450%G,450%T,450%T,450%T,450%G,450%T,450%G,450%G,450%G,450-,450-,450-,450+C,451%T,451%C,451%T,451%T,451%T,451%A,451%T,451%A,451%A,451%T,451%A,451%T,451%T,451%C,451%C,451%A,451-,451-,451+T,451+T,451+T,452%T,452%T,452%G,452%C,452%G,452%G,452%C,452%T,452%C,452%G,452%G,452-,452+T,452+C,452+A,453%G,453%G,453%C,453%A,453%G,453%C,453%G,453%G,453%G,453%A,453%C,453%G,453%G,453-,453-,453+G,453+G,454%G,454%C,454%T,454%T,454%T,454%T,454%C,454%C,454+C,454+T,454+G,455%G,455%G,455%T,455%A,455%G,455%T,455%A,455%A,455%A,455%A,455%G,455%G,455%T,455%T,455%T,455+T,455+C,456%A,456%T,456%T,456%A,456%T,456%G,456%T,456%G,456%A,456-,457%A,457%G,457%G,457%G,457%A,457%T,457%A,457%G,457+A,457+T,457+C,458%G,458%G,458%G,458%G,458%G,458%A,458%G,458%G,458%A,458%A,458%G,458%C,458%C,458-,458+T,459%A,459%T,459%C,459%C,459%C,459%C,459%T,459%A,459%A,459%C,459-,459-,459+C,459+T,460%C,460%A,460%C,460%T,460%A,460%T,460%C,460%C description="K_Bacteria; P_Firmicutes; C_Bacilli; O_Lactobacillales; F_Lactobacillaceae; G_Pediococcus; S_Pediococcus acidilactici."
CCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGATGGAGCAACGCCGCGTGAGTGAAGAAGGGTTTCGGCTCGTAAAGCTGCTGTTGTTAAAGAAGAACGTGGGTGAGCGTAACTGTTTACCCAGGTAGGTATTTAACCAGCACGCCAGGGCTAAATGACATGCCAGCAAACGCTGTAATACGAAGGTTGCAGGCGTCCACGGAATATCCTAAGACATAATCTATACTGAGATGACTGAGGATTGAATCTAATTATGCGGCTTCCCGTATGGCAAAAGTTAGTATGAGCACTCCGCTTCGCATCATCAGTCATCACGCTAAACTCTCACCTGTCATTTTCGGTTGTAAAGCAAGCGACACCTCAATTGATTCGCGATTGCTCTTCTCTCGACACATCCTGACATACCTTTATTATCGTTCGTTCTCTACTACGGCCGCCTTTGATGGCGTCGCATCGTCGCAAGATCTTTAGGGGGTAAAAAGACCTTTTCAGGCCTGTTCGATCTCTC
+
???????????????????????????????????????????????????????????????????????????????????????????????0???????????????????????????0?????????0??????00??????????????0?0????0??????0?0??0????????00???0????????0????0????000?000????0?0000?00?0?0?0?0000000000000?000?0000??000000000?0000000?0000000?000000000000000000000?000000000?00000000000000000?0000000000000000000000?0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
@3 reference=R0175-3 amplicon=327..771 position=1..445 errors=112%T,139+C,140%T,155%A,165%G,167%A,168%T,175%T,175%C,179%C,179%T,188+G,189%A,191+C,193%T,197%A,199%G,202%C,206%A,207%T,208%C,211-,212%C,213%G,214%T,215%T,219%A,219%A,220+A,221%T,222%G,222%A,222%A,223%G,227%T,227%C,229%G,229+C,230%C,231-,232+T,233-,233+A,234-,235%C,235%T,236%A,237%T,237%T,238%C,240%G,240%G,240%T,242%C,243%A,246%T,247%C,247%T,247%T,247%T,251+A,252%A,254%C,254%C,255%C,257%A,258%A,259%C,260%C,260%C,260+C,261%T,261-,262%G,263%G,263%G,263%A,263%A,264%A,265%T,265%A,265%A,266%C,267%A,267%A,267%T,268%T,269%G,269-,271%A,272%G,272%T,272%G,273%C,273+G,274%A,274%T,274+T,276%T,277%T,277-,278%A,278%T,278%C,278%C,278%T,278%T,278+T,279%A,279%T,279%A,279%A,280%T,280-,281%C,281-,282%T,283%A,284%C,284%A,285%A,285-,286%T,286%A,286-,287%T,287%G,287%G,287%T,287%A,287-,287+T,288%C,288%T,288%A,288%A,288-,289%C,290%T,290%C,290+C,291%T,292%G,292%A,293%G,293%C,294%T,295%C,295%G,295-,295+C,296%A,296%C,297%A,298%A,298%C,298%T,298-,299%T,299%G,299%G,299%A,299-,299+A,300%C,300%A,301%T,301%T,301%C,301-,302%G,302%G,302%A,302%C,302%G,302-,303%C,303%T,303%T,303%T,303%G,304%C,304%T,305%T,305%C,305-,306%A,306%A,307%A,307%A,307%A,307%C,307%C,308%C,309%T,310%C,310%G,310%T,311%G,311%T,311%A,311%T,311%A,311%T,312%G,312%G,312%C,312%C,312%C,313%T,313+C,314%A,314%T,315%C,315-,316%T,317%G,317%A,317%G,318%A,318%A,318+T,319%T,319%A,319%A,321%A,321-,322%T,322%A,322%C,322%A,322%C,322%T,322%C,323%C,323+C,323+G,324%C,324%A,324%A,324%A,324-,324-,325%A,325-,325+T,326%A,326%C,326%G,326%C,326+A,327%C,328%C,328%G,328%G,328%T,328%C,328%C,328%G,328%G,328+G,328+T,329%A,329%A,329+C,330%T,330%T,330%C,330%T,330-,331%A,331%A,331%A,331+C,331+C,332%G,332%G,332%G,332%G,333%T,333%C,333%A,334%T,334%A,334%C,334%C,334%T,334%C,334%C,335%C,335%G,335%C,335%C,335%C,335%C,335%T,336%T,336%G,336%G,336%G,336%T,336%T,336+C,337%A,337%A,337+T,338%C,338%T,338%C,338%T,338-,339%G,339%A,339%C,339%A,339%C,339+C,340%C,340%T,340%A,341%A,341%C,341%A,341%C,341%G,342%G,342%T,342%T,342%C,342%C,342%T,342%T,342-,343%C,343%A,343%C,343%C,343-,344%G,344%G,344%C,344%T,344%C,344%T,344%C,344%C,344%C,345%C,346%T,346%T,346%G,346%G,346%T,346%T,346%G,346-,347%A,347%C,347%A,347%A,347%C,347%G,347+G,347+A,348%G,348%A,348%T,348%T,349%C,349%C,349%A,349%A,349%C,349%T,349%T,349-,349-,349-,349+C,350%T,350%A,350%C,350%T,350+A,351%T,351%A,351%T,351-,351+T,352%G,352%T,352%C,352%T,352+G,353%T,353%C,353%C,353%T,353%T,353+G,354%T,354%C,354%T,354%C,354%T,354-,354+G,355%T,355%C,355%G,355%C,355%G,356%G,356%T,356%G,356%G,356%G,356%C,357%T,357%G,357-,357+T,358%T,358%T,358%T,358%G,358+C,359%A,359%T,359%T,359%T,359-,360%G,360%A,360%G,360%A,360%T,360-,360+T,361%T,361%T,361%T,361%G,361%T,361+C,362%G,362%T,362%T,362%G,362%C,362%C,363%C,363%A,363%A,363-,363-,363+G,364%A,364%C,364-,364-,364-,364+T,365%T,365%A,365%C,365%A,365%C,366%T,366%G,366-,366+C,367%A,367%C,367%A,367%C,367-,367-,368%T,368%C,368%T,368%G,368%G,368-,369%C,369+T,370%A,370%A,370%T,370%A,370%C,370%T,370%C,370%A,370%T,370+G,371%A,371%A,371%A,371%T,371%C,371%A,372%A,372-,372-,372-,372-,373%T,373%T,373%G,373%C,373%C,373%G,373%G,374%A,374%T,374%A,374%A,374%A,374%T,374%C,374%A,374%T,375%C,375%A,375%C,375%T,375%A,375%T,375%C,375%T,375%A,375+C,375+G,375+G,376%A,376%C,376%G,376%A,376+G,377%G,377%A,377%T,377%A,377%G,377+G,378%C,378%A,378%C,378%A,378-,378+A,378+C,379%T,379%T,379%G,379%A,379%G,380%G,380%A,380+G,381%A,381%A,381%C,381%C,381%T,381%A,381%T,381-,381-,381-,382%C,382%C,382%T,382%A,382%A,382%C,382%A,382-,382+C,383%C,383%A,383%A,383-,384%A,384%G,384%G,384%A,384%A,384%G,384%T,384-,384-,385%A,385%G,385%T,385%A,385%T,385%A,385%A,385-,386-,387%G,387%G,387%C,387%A,387-,387+G,387+G,387+C,388%G,388%A,388%G,388%C,388%C,388%C,388%G,388%C,388%C,388%A,389%T,389%T,389%C,389%T,389%C,389%C,389%C,389%G,389+G,390%T,390%G,390%T,390+A,390+C,390+C,391%G,391%C,391%C,391%C,391%G,391%C,391%G,391%A,391-,391-,392%C,392%A,392%A,392%A,392%T,392%A,392%C,392%A,392%T,392-,393%G,393%C,393%G,393%T,393%T,393%C,393+A,394%G,394%A,394%T,394%T,394%T,394%T,394%A,394%T,394+T,395%T,395%C,395%A,395%T,395%A,395-,395-,395-,395+T,396%A,396%A,396%T,396%G,396%T,396-,396+T,396+A,396+G,397%G,397%A,397%C,397%C,397%G,397-,398%T,398%T,398%A,398%C,398%A,398%A,398%T,398%T,398%A,398-,398+T,399%T,399%T,399%G,399%T,399%T,399%T,399+G,399+G,400%T,400%A,400%T,400%T,400%T,400%A,400-,400-,400+A,401%A,401%C,401%A,401%C,401%C,401%C,401%A,401-,402%G,402%C,402%G,402%G,402%G,402+A,403%A,403%A,403%T,403%T,403%A,403%C,403%A,403%T,403%T,403+C,404%G,404%G,404%T,404%G,404%T,404%G,404%A,404%A,404%A,404%G,404%T,404-,404-,404+C,405%A,405%C,405%T,405%T,405%C,405%T,405+G,406%G,406%C,406%G,406%C,406%G,406%C,406%C,406%G,406%T,406-,406+A,407%G,407%T,407%C,407%G,407%T,407%G,407%T,407%G,407%T,407-,407+G,407+C,408%T,408%G,408%T,408%G,408%G,408%C,408+G,408+A,409%C,409%A,409%A,409%C,409%A,409%C,409%A,409%A,409-,409-,409+T,410%A,410%A,410%A,410%A,410%T,410%T,410%T,410%T,410%T,410-,411%C,411%C,411%C,411%A,411-,411-,411+G,412%C,412%A,412%G,412%A,412%C,412%C,412%C,412%G,412%A,412%C,412%A,412%G,412%C,413%T,413%A,413%A,413%T,413%C,413%A,413%A,413%A,413-,413-,413+C,414%T,414%T,414%C,414%A,414%T,414%C,414%T,414-,414-,414+G,415%T,415%T,415%A,415%C,415%T,415%C,415%A,415%T,415%A,415%A,415%T,416%A,416%T,416%T,416%C,416%T,416-,416+C,416+C,417%G,417%C,417%T,417%C,417%T,417%G,417%G,417%T,417%G,417%G,417%T,417-,417+C,418%C,418%A,418%T,418%T,418%A,418%C,418%T,418%A,418-,419%T,419%T,419%A,419%G,419%T,419%A,419%G,419%G,419%A,419%T,419%T,419%G,419-,419-,420%T,420%A,420%A,420%A,420%T,420-,420-,420+A,420+A,421%T,421%C,421%C,421%G,421%G,421%T,421%T,421%C,421%T,421%T,421%T,421%T,421%G,421%T,421%C,421%T,421-,421-,421+T,422%G,422%G,422%G,422%G,422%C,422%T,422%C,422%G,422%C,422%C,422-,422-,423%T,423%G,423%G,423%G,423%A,423%T,423%G,423+C,424%C,424%T,424%T,424%C,424%G,424%C,424%G,424%T,424%G,424%C,424%G,424-,424+T,424+C,425%T,425%A,425%A,425%T,425%T,425%C,425%A,425%T,425%A,425%C,425%A,425-,425-,426%T,426%C,426%T,426%T,426%C,426%A,426%A,426%T,426%A,426%T,426%C,426+C,426+G,426+G,426+C,427%C,427%G,427%G,427%G,427%C,427%G,427%T,427%G,427%G,427-,427+C,427+C,428%G,428%C,428%C,428%C,428%G,428%G,428%C,428-,428+C,429%A,429%C,429%G,429%C,429%A,429%C,429%C,429%G,429-,429-,429+G,430%C,430%G,430%T,430%C,430%T,430%T,430%C,430%T,430-,430-,431%C,431%C,431%A,431%C,431%C,431%C,431%T,431%A,431%A,431%C,431%T,431%C,431%C,431%A,431%A,431%A,431%A,431%T,431%A,431-,431-,431+A,432%T,432%T,432%G,432%C,432%C,432%T,432%T,432%G,432-,432+A,432+G,432+G,432+T,433%C,433%A,433%G,433%A,433%G,433%G,433%A,433%C,433%C,433%A,433%C,433-,433-,433-,433+T,434%T,434%T,434%C,434%C,434%C,434%T,434%C,434%G,434%T,434%T,434%T,434%T,434-,435%G,435%G,435%A,435%T,435%T,435%T,435%A,435%A,435%T,435%G,435-,436%G,436%A,436%G,436%G,436%G,436%A,436%A,436%T,436%G,436%G,436%T,436-,437%G,437%T,437%T,437%G,437%G,437%G,437%T,437%T,437%G,437%T,437-,437-,438%A,438%C,438%G,438%G,438%A,438%A,438%A,438%C,438%C,438-,438-,438+A,438+A,439%C,439%A,439%A,439%C,439%A,439%A,439%C,439%A,439%A,439%T,439%T,439%A,439-,439-,440%C,440%A,440%T,440%A,440%T,440%C,440%T,440%A,440%T,440%A,440%A,440%A,440%C,440%T,440%T,440%A,440%A,441%C,441%G,441%C,441%C,441%G,441%G,441%G,441%C,441%A,441%C,441%A,441%A,441%A,441-,441-,441-,441-,441+C,441+C,442%C,442%C,442%T,442%G,442%T,442%G,442%C,442%G,443%A,443%A,443%T,443%A,443%T,443%C,443%A,443%A,443%A,443%T,443%C,443%T,443-,443-,443-,443+T,443+T,443+G,443+T,444%A,444%C,444%G,444%G,444%C,444%G,444%G,444%C,444%G,444%G,444%G,444%G,444%C,444%A,444%C,445%T,445%G,445%A,445%A,445%T,445%A,445%T,445%A,445-,445+A,445+C,445+A,445+C description="K_Bacteria; P_Actinobacteria; C_Actinobacteria; O_Bifidobacteriales; F_Bifidobacteriaceae; G_Bifidobacterium; S_Bifidobacterium longum subsp. longum"
CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTATCGGGGAGCATGCGAGAGTGAGTTTACCCGTTGAATAACTCACCGGCTAACTACATGCCAGCAGGCATGGTAATCCGTTGGGTGCAAGGAGTCTTTCCAGGATCATTATCCGCGTTGGCACATAGGGCCGGCCGTATATCCTGCAGTTTAAGTAACCCCAACCCGAAACTTTAGCGTTGTTTATAATCCCTACTCCAAAGTACCTTTCTCTTGATACCCCGTCACGGTACACCGACTTCATCCAGCCGGATCTATTGTGGGCTGCTTCCGTCCCTTGAGTACGGAGGGACGAGCGGCAGGTACCCATTTTAGTTGGAGATCCTGAGCCGATGCCGTCCCAATGCTCCCGGCCCCGAAGGTTAAACCGTTGTCACAC
+
???????????????????????????????????????????????????????????????????????????????????????????????????????????????0???????????????????????????00??????????????0?????????0?00??????0???0?????????00??0?0???0?0??0???000??0000???0?0000???0?000?000000?0?00??00????00?00?000000000000?000000?0000000000000000000000000000000000000?000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
 [....]
@73134 reference=R0175-3 amplicon=327..771 position=1..445 errors=93%T,127%G,130%T,130%A,130-,147%A,147%A,149%G,151%A,152+T,153%C,157%C,159%G,160%T,162%A,169%C,170%A,170%C,172%G,175%T,177%A,178%C,180%C,187%T,188%T,189%T,190%T,193%G,193+G,194%G,196+G,197%A,197%A,198%C,200%G,203%T,204%A,208%A,208%A,209%G,211%A,212%G,214%C,217%T,217+G,222%C,223%C,223%T,225%C,226%T,226-,227-,228%T,229+C,230%C,232%T,232%A,233%A,235%C,235%T,235%A,235%C,236%A,237%C,238%G,239%T,239%G,240%A,240%A,241%A,241%C,242%A,245%C,245%G,246%T,246%C,247%G,248%C,248%G,248%C,249%G,249%T,249-,249+C,250%T,251%C,251%A,251-,253%G,255%C,255+T,256%G,257%A,257%T,258%G,258%T,258%A,258-,259%G,259%G,260%C,260%C,260%A,260+A,261%G,261-,262%G,262+G,263%A,264%T,265%A,265%C,266%C,267%T,267%A,268%C,268%A,268%T,268%T,271%G,271%A,273+C,273+A,274%G,275%T,275%T,275%C,275%A,275%C,276%T,277%T,278%A,278%T,278-,279%A,279%T,279%T,280%A,280%T,281%G,281%C,281-,282+G,283%G,283%T,284%T,284%T,284%C,284%A,286%C,286%T,286%A,287%T,287%T,287%T,287-,289%T,289%A,289%A,289%A,289%T,289-,289+G,290%C,291%T,292%G,292+C,293%G,293%G,294%T,294-,295%C,295%C,295%T,295%T,295%T,296%A,296%A,296%C,296%A,296+T,297%G,297%C,297%C,297-,298%C,298%A,298%C,298%A,298+A,299%A,299%T,299%T,299%A,299%T,299-,299+T,300%C,300%A,300%C,300-,300+A,301%T,301%C,301+G,302%A,302%C,302%C,302-,303%G,303%G,303%T,303%C,303-,303+C,304%A,304%A,304-,304+A,305%T,305%T,307%C,307%C,307%T,307%T,307%T,307%T,308%T,308+A,309%C,309%C,309%A,309-,309+G,311%T,311%T,311+A,312%G,312%C,312%C,312%C,312%C,312%G,312-,313%T,313-,313-,313-,314%A,314%A,314%T,314%C,314%T,314%T,314%T,315%C,315%G,315%G,315%G,315+C,316%T,316%G,316%G,316%G,317%G,317%C,317%C,317%A,317%A,317%G,317-,317+G,318%C,318%A,318%A,318%G,318%C,318%C,319%A,319%A,319%A,319%G,319+G,319+T,320%G,320%A,320%G,320%A,320-,321%A,321%A,321%G,321%A,322%C,322%C,323%T,323%A,323%A,323%T,323%A,323%A,324%C,324%C,324%C,326%A,326%A,326%C,327%G,327%T,327%G,327%T,327+C,328%T,328%G,329%A,329%A,329%T,329%A,329%G,329%A,330%A,330%C,330%C,330%C,330%A,330%T,330%A,330%A,330%C,330%T,330-,330+C,331%T,331%C,331%T,332%C,332%C,332%A,332+G,333%T,333%A,333%T,333%A,334%C,334%A,334%T,335%G,335%G,335+A,336%C,336%G,336%C,336%T,336%C,336%C,336-,336+C,337%A,337%G,337-,338%C,338%A,338-,338-,338+G,339%C,339%A,339%A,339-,339+T,339+T,340%C,340%T,340%C,340%A,340%A,340%T,340+T,341%C,341%G,341%A,341%G,342%G,342%G,343%A,343%A,343%A,343-,344%C,344%T,344-,345%A,345%G,345%C,345-,346%G,346%T,346%T,346-,347%C,347%G,347%C,347%C,348%A,348%T,348-,349%T,349%T,349%C,349%C,349%A,349%C,349%C,349%C,349%C,349%C,349-,350%A,350%C,350%T,350%T,350%T,350%C,350+C,351%T,351%A,351%A,351%A,351%C,352%T,352%C,352%T,352%T,352%T,352%C,352%T,352+T,353%T,353%G,353%G,353-,353-,353+C,353+A,353+C,354%T,354%T,354%A,355%G,355%C,355%C,355%G,355%C,355%T,355-,355+A,356%G,356%T,356%G,356%T,356%G,356+T,356+A,357%G,357%A,357%G,357%T,357%T,357%A,357+A,357+T,358%C,358%T,359%A,359%A,359%A,359%T,359%T,359%G,360%A,360%T,360%G,360%G,360%T,360%G,360-,361%T,361%G,361%C,361%T,361%T,361%C,361%G,361+C,362%G,362%G,362%G,362-,362-,363%A,363%A,363%A,363%A,363%A,363%A,363%C,363%A,363%C,363-,364%A,364%C,364%C,364%T,364%A,364%T,364%C,364%T,364-,365%T,365%T,365%A,365%T,365%T,365%C,365%T,365%A,365+A,366%T,366%G,366%G,366%A,366%A,366%A,366%G,366-,366-,366+C,367%A,367%A,367%T,367%A,367%T,368%C,368%C,368%G,368%C,368-,369%G,369%C,369%G,369-,370%A,370%A,370%C,370%C,370%C,370%C,371%T,371%A,371%A,371%A,371%T,371-,372%G,372%A,372%T,372%T,372%T,372%A,372%A,372%G,372%G,372+G,372+A,373%C,373%C,373%G,373%C,373%C,373+A,374%T,374%A,374%C,374%T,374-,375%T,375%A,375%T,375%A,375%T,375%A,375%A,375%T,375%T,375%A,375%T,375-,375+A,375+T,376%C,376%C,376%C,376%A,376%G,376%A,376-,376+A,377%T,377%A,377%A,377%T,377%A,377%A,377+A,378%A,378%G,378%A,378%A,378-,379%T,379%T,379%G,379%G,379%T,379%G,379-,380%G,380%C,380%C,380%C,380%G,380%A,380%C,380%C,380+G,380+A,381%C,381%A,381%A,381%A,381%T,381%T,381%C,381%A,381-,381-,381+T,381+G,382%A,382%A,382%A,382%T,382%T,382%C,382%A,382%T,382+T,383%C,383%C,383%T,383%T,383%A,383%C,383%C,383%A,383%C,383-,383-,383+G,383+C,384%A,384%G,384%T,384%G,384-,384-,384-,385%G,385%A,385%A,385%A,385%G,385%G,385-,385-,386%A,386%C,386%A,386%A,386%A,386%T,386%T,386-,386-,386-,387%G,387%G,387%A,387%G,387%A,387%C,387%G,387%C,387%A,387%G,387%C,387-,388%A,388%C,388%C,388%G,388%A,388%G,388%C,388%C,388%A,388%C,388%C,388-,388-,388+C,389%G,389%T,389%G,389%T,389%T,389%T,389-,389-,389+C,390%G,390%A,390%A,390%T,390%T,390%T,390%A,390%G,390-,391%C,391%A,391%G,391%C,391%G,391-,391+A,391+A,392%A,392%T,392%A,392%A,392%C,392%C,392%A,392-,392+T,392+T,393%C,393%C,393%G,393%G,393%T,393%G,393%T,393+A,394%T,394%T,394%A,394%A,394%G,394%T,394-,394+C,394+G,395%A,395%A,395%A,395%A,395%C,395-,395+G,396%G,396%G,396%G,396%A,396%T,396%T,396%G,396+T,396+T,397%C,397%G,397%G,397%C,397%C,397%A,397%A,397%A,397%G,398%A,398%A,398%C,398%T,398%A,398-,398+G,398+T,398+T,399%G,399%G,399%T,399%C,399%T,399%C,399%T,399%C,399%G,399%T,399+C,400%T,400%C,400%C,400%C,400%T,400%T,400%C,400%T,400%T,400-,400+A,401%T,401%C,401%A,401%C,401%C,401%C,401%C,401-,401-,401+C,401+A,402%G,402%C,402%C,402%T,402%C,402-,403%C,403%C,403%A,403%C,403%C,403%T,403%A,403%A,403%A,403%C,403-,403+G,404%A,404%T,404%A,404%G,404%G,404%T,404%T,404%T,404%T,404%A,404-,404+A,405%A,405%T,405%A,405%T,405%A,405%T,405%C,405-,405+G,405+A,406%C,406%T,406%T,406%C,406%G,406%G,406%T,406%C,406%G,406%C,406%G,406%G,406%C,406-,406+T,407%G,407%C,407%T,407%T,407%G,407%G,407%C,407-,407-,408%C,408%C,408%G,408%C,408%C,408%T,408-,408-,408-,409%A,409%C,409%C,409%T,409%T,409%C,409%A,409%A,409%A,409-,409-,409+C,410%A,410%G,410%G,410%A,410%G,410%T,410%T,410%A,410%G,410%A,410%A,410%G,410%A,410-,410+T,411%C,411%C,411%A,411%A,411%A,411%C,411%C,411%T,411%C,411%C,411%A,411%T,411%C,411-,411+C,411+C,412%A,412%A,412%C,412%C,412%G,412%C,412%C,412%A,412%G,412%C,412%G,412%C,412%G,412%G,412%A,412-,412-,413%T,413%A,413%A,413%A,413%T,413%A,413-,414%T,414%C,414%T,414%A,414%T,414%C,414%T,414%T,414%C,414%T,414%T,414%T,414+G,415%A,415%A,415%A,415%C,415%C,415%C,415%T,415%T,415%A,415%C,415%C,415-,415-,415+T,415+C,416%T,416%C,416%T,416%A,416%A,416%A,416%A,416%T,416%C,416%T,416%T,416-,416-,416-,416+A,417%C,417%G,417%G,417%G,417%T,417%T,417%C,417%C,417%C,417%T,417%C,417-,417+G,418%C,418%C,418%T,418%A,418%A,418%C,418%A,418%A,418%A,419%G,419%G,419%G,419%A,419%T,419%T,419%A,419%A,419%T,419%G,419%G,419%T,419%T,419-,420%A,420%C,420%T,420%T,420%A,420-,420-,421%G,421%T,421%T,421%T,421%T,421%G,421%T,421%T,421%C,421%C,421%T,421%C,421%G,421%T,421%C,421+G,421+A,422%G,422%C,422%C,422%T,422%T,422%C,422%C,422%T,422%T,422%C,422%C,422+A,423%A,423%G,423%G,423%T,423%T,423%T,423%A,423%A,423%T,423+G,423+T,424%C,424%T,424%T,424%C,424%G,424%T,424%G,424%G,424%C,424%T,424-,424-,424-,424+A,424+G,425%T,425%C,425%C,425%A,425%T,425%C,425%C,425%C,425-,425-,425-,425+T,426%C,426%T,426%C,426%A,426%T,426%C,426%T,426%T,426%A,426%A,426%T,426%T,426%T,426%T,426-,426+A,426+C,427%T,427%C,427%G,427%G,427%G,427%T,427%C,427%T,427-,428%A,428%C,428%G,428%A,428%A,428+G,429%G,429%G,429%A,429%G,429%A,429%G,429%C,429%A,429%G,429%A,429%G,429%G,429-,429-,430%G,430%G,430%T,430%G,430%C,430%T,430%G,430-,430+G,431%A,431%A,431%A,431%T,431%C,431%A,431%A,431%T,431%A,431%C,431%C,431%A,431%C,431-,431-,431-,431+C,432%C,432%T,432%G,432%G,432%G,432%G,432%C,432%G,432%C,432%C,432%C,432%T,432%G,432%G,432-,432-,432-,432+A,432+C,432+C,432+C,432+C,433%A,433%A,433%G,433%G,433%C,433%A,433%C,433%A,433%G,433%A,433%G,433%C,433%C,433%C,433%G,433-,434%T,434%T,434%G,434%G,434%C,434%T,434%C,434%G,434%T,435%G,435%A,435%T,435%T,435%A,435%T,435%A,435%T,435%G,435%A,435%G,435%T,435-,436%A,436%T,436%G,436%T,436%A,436%G,436%A,436%G,436%A,436%G,436%T,436+C,436+A,436+C,437%A,437%T,437%T,437%G,437%G,437%A,437%G,437%A,437%A,437%A,437%A,437+A,437+T,437+G,438%A,438%C,438%C,438%A,438%C,438%G,438%A,438%A,438%A,438%C,438%C,438-,438+G,438+T,438+A,439%A,439%A,439%C,439%T,439%T,439%T,439%T,439%T,439%A,439%T,439%C,439%T,439-,439+T,440%A,440%T,440%T,440%A,440%C,440%T,440%C,440%A,440%A,440%C,440%A,440%T,440-,440-,440-,440+G,440+T,441%A,441%A,441%C,441%G,441%A,441%A,441%A,441%G,441%G,441%C,441%G,441%G,441%G,441%A,441%A,441%C,441+C,441+T,442%T,442%T,442%C,442%G,442%G,442%C,442%G,442%C,442%G,442-,443%T,443%T,443%T,443%A,443%A,443%T,443%A,443%C,443%A,443%C,443%C,443+T,443+T,444%C,444%A,444%C,444%A,444%A,444%C,444%C,444%C,444%A,444%A,444%A,444%C,444%G,444%C,444%C,444-,444-,444-,444+C,445%G,445%T,445%G,445%A,445%A,445%A,445%T,445%G,445%T,445%T,445%A,445+A description="K_Bacteria; P_Actinobacteria; C_Actinobacteria; O_Bifidobacteriales; F_Bifidobacteriaceae; G_Bifidobacterium; S_Bifidobacterium longum subsp. longum"
CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAATCTCTTTTATCGGGGAGCAAGCGAGAGTGAGTTTGCCGTTGAATAAGCACCGGATGAATTCCGTCCGTGAAGCCGCCCTGATTCACACGGTGCATTTTTTGGGCCGACAGTTTATGGAGGAGACGGTGCTCGCTGCTTCCCAACCACGGACATGGCGCCTCGACTGTGAAGGATCCATATACGCAGCTTTTAGTAGAGGCTGCGTATAATACGCATGTTAGATATGCGGCGGTACACGCTCGACTAGATGACGTTTTGGCCCCTTCACAAGTAAATTGGCAACTCGGACAATAAACGATGTTGCCCAATTTACGGGTTGGTTTCACAGAGATCTCCTGTCAGACGACATGTAGTACAGGCACCCCTTCACAATGGTATGTCCTCTTCAA
+
????????????????????????????????????????????????????????????????????????????????????????????0?????????????????????????????????0??????????????????0?0?0?00???0?00?0??????00?0??0?00?0??????0000??000??000?0??00???00?00?0??00????00?00?00?00?00000000??000000?0?000000000000000??0??00000000?000?0?000000000000000000?0000?000000000000000?0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
@73135 reference=R0070-58 amplicon=328..777 position=1..450 errors=126%A,127-,138%A,143%G,144%C,146%T,154%C,155%G,166%C,170%A,170+C,172-,174%A,176%A,184%C,184%G,184%G,185%C,188%G,199%G,200-,202%A,203%C,203+G,208%G,209%G,211%T,213%A,214%T,214%G,214%T,214+G,221%T,222%C,222%C,223%A,223%A,224%G,225%T,225%A,225+T,227%C,227-,228-,229%T,229%C,230%T,230-,230+A,231%G,231%A,233%C,233%T,234%A,234%G,235%G,235+A,236%T,237%C,237%C,238%G,239%G,240%T,241-,242%C,242-,243%G,244+A,244+A,245%T,246%T,246%C,246+C,248%C,249%T,249%A,249%T,250%C,250%G,250%C,250-,251%T,252%C,253%G,254%C,254%T,254%T,254+G,255%A,255%A,255+C,256+T,258%A,259%G,260%C,261%A,261-,262%T,264%G,264%G,264+T,265%C,265%C,266%C,266+A,267%C,268%A,268+G,269%A,270%T,271%C,271-,271-,272%T,272%A,272+G,273%A,273%A,274%G,274%C,275-,276%A,277-,277+G,278%T,279%A,279%A,280%A,281%A,281%A,281+A,282%A,282%G,282%A,283+T,285%C,285%A,286%A,286%C,287%G,287%C,287-,288%G,289%A,290%C,292%G,292%A,292%A,292%G,295%A,295%C,295-,295-,296%T,296%T,296-,296+G,297%A,297%G,297%A,297%A,297%A,297%G,297+C,298%C,299%A,299%A,299%C,299%T,300%T,301%A,301%C,301-,301+A,301+T,302%G,303%A,303%T,303%A,304%T,304%G,304%A,304%T,305%A,306%A,306%T,306%C,307%A,307%A,307%C,307%C,308%T,308%T,308%G,309%A,309%A,309%A,309%T,309%A,309-,309+C,310%C,311%C,311%T,311%C,311%C,312%C,312%A,312%T,312%T,312%A,312-,313%T,313%G,313%T,313%C,313%C,313%T,313-,314%C,314%A,314%T,314%T,315%G,315%C,315%T,315%T,315%C,315%T,315-,316%A,316%A,316%G,316%T,316%G,316%T,316%A,316-,317%A,317%A,318%C,318%C,318%A,318%C,318%A,318+C,319%A,319%C,319%T,319%T,319%A,320%T,320%C,320%C,320%T,320%T,320%G,321%C,321%G,321%T,321%C,322%A,322%C,323%C,323%A,323%C,323%A,323%G,324%A,324%T,325%T,325%T,325%T,325%A,326%G,327%A,327%T,327%C,328%A,328%A,328%A,328%T,328%A,329%C,329%C,329%G,329%A,330%A,330%A,330%T,330%T,330%C,330%T,331%A,331%A,331%G,331%G,331%A,331%A,331%C,332%T,332%T,332%C,332%T,332%T,332-,333%C,333%T,333%G,333+T,333+A,334%A,334%T,334%T,334%G,334%T,334-,334+C,335%C,335%C,335+A,336%T,336%T,336%T,336%C,336%C,336%C,336-,336-,337%A,337%G,337%G,338%A,338%C,338%T,338%T,338-,339%C,339%T,339%T,339%A,339%A,339-,339-,340%C,340%T,340%G,341%G,341%G,341%G,341%T,341-,342%A,342%A,342%G,342%A,342%A,342%C,342%C,342%C,342%A,342-,342+C,342+C,343%T,343%A,344%C,344-,345%A,345%C,346%C,346%A,346%G,346%G,346%A,347%C,347%T,347%C,347%G,347%G,347-,347+A,348%C,348%T,348%T,348%C,348%T,348-,348+C,349%T,349%T,349%C,349%C,349%G,349-,350%A,350%A,350%A,351%G,351%C,351%G,352%A,352%G,352%G,353%G,353%G,353%T,353%A,353%T,353-,353+G,354%T,354%A,354-,355%T,355%T,355%A,355%C,356%C,356%C,356%T,356%C,356%A,356%A,356%T,356+T,357%G,357-,357+T,358%G,358%G,358%T,358+T,359%T,359%T,359%T,359%C,359-,359+T,360%T,360%G,360%C,360%C,360+G,361%G,361%C,361%C,361%G,361%C,361-,361-,361+C,362%G,362%A,362%G,362%G,362+C,362+C,363%C,363%T,363%G,363-,363-,364%T,364%T,364%A,364%A,364%T,364%T,364+T,364+T,365%T,365%A,365%G,365%G,365%A,365%A,365%T,365+C,366%G,366%C,366%C,366+T,366+G,367%C,367%T,367%C,367%C,367%G,367%G,367%C,367+C,368%C,368%G,368%A,368%G,368+C,369%A,369%A,369%T,369%A,369%T,369-,370%A,370%T,370%T,370%T,370%C,370+G,371%A,371%A,371%A,371%G,371%A,371%G,371%T,371-,371-,372%C,372%A,372%T,372%T,372%T,372-,372+A,373%T,373%T,373%T,373%C,373%G,373%C,373-,373+G,374%G,374%T,374%C,374%G,374%C,374%C,374%T,375%A,375%A,375%T,375%T,375%C,375%T,375%C,375%T,375%C,375%C,375+G,376%T,376%A,376%T,376%A,376%A,376%T,376%T,376%A,377%T,377%T,377%G,377%G,377%A,377+C,378%T,378%C,378+A,379%T,379%C,379%T,379-,379+C,380%C,380%T,380%A,380%T,380%A,380%T,380%A,380+T,380+T,381%A,381%C,381%A,381%A,381%C,381%A,381%C,381%C,381%A,381+A,381+C,382%A,382%T,382%A,382%A,382%T,382+G,383%A,383%A,383%G,383%A,383%A,383%A,383%G,383%C,383-,384%T,384%G,384%T,384%A,384%G,384%A,384%G,384%A,384%G,384+C,384+G,384+T,385%C,385%A,385%A,385-,385+A,385+A,386%C,386%A,386%T,386%A,386%A,386%T,386%C,386%T,386%T,386%A,386%C,386+A,387%T,387%C,387%C,387%A,387%T,387%C,387+C,388%A,388%C,388%C,388%T,388%C,388%C,388%C,388%A,388%C,388%T,388%A,388%T,388%T,389%G,389%G,389%A,389%T,389%G,389%A,389-,389-,389-,389+T,389+G,390%A,390%T,390%G,390%G,390%A,390%A,390%G,390-,390-,390-,390+G,391%C,391%C,391%T,391%T,391%C,391%A,391%C,391-,391-,391+A,392%G,392%C,392%C,392%C,392%C,392%A,392%C,392%A,392%G,392-,392-,392+G,392+C,392+C,393%A,393%G,393%C,393%C,393%C,393%G,393%A,393%A,393-,393-,393-,394%G,394%C,394%G,394%T,395%G,395%G,395%G,395%A,395%T,395%A,395%T,395-,396%C,396%C,396%G,396%G,396%C,396%G,396%A,396%C,397%T,397%C,397%C,397%C,397%C,397-,397-,398%T,398%T,398%T,399%T,399%A,399%G,399%G,399%G,399%G,399%G,399%A,399%T,399%T,399%T,399-,399-,400%A,400%A,400%T,400%T,400%C,400%A,400%C,400-,401%A,401%T,401%G,401%G,401%A,401%G,401-,401-,401+G,402%A,402%G,402%C,402%A,402+C,403%A,403%C,403%C,403%A,403%A,403%C,403%T,403+T,403+T,404%C,404%C,404%G,404%T,404%C,404%C,404%G,404-,405%C,405%T,405%C,405%A,405%T,405%A,405%A,405%C,405-,405-,405-,405+T,406%T,406%T,406%T,406%T,406%T,406%A,406%T,407%C,407%T,407%C,407%T,407%G,407%T,407%G,407%T,407%C,407%C,407%C,407%C,407-,408%A,408%A,408%T,408%A,408%A,408%C,408%A,408%C,408%T,408%A,408%A,408%A,408%C,408%C,408%T,408%T,408%C,408-,408-,408+C,409%G,409%G,409%T,409%T,409%A,409%A,409%G,409%T,409%T,409-,409-,409+A,410%A,410%T,410%T,410%C,410%T,410%T,410%C,410%C,410%A,410-,410+C,410+G,410+C,410+G,411%T,411%G,411%G,411%G,411%C,411%T,411%C,411%T,411-,412%G,412%C,412%T,412%C,412%T,412%T,412%G,412%C,412-,413%C,413%G,413%T,413%T,413%G,413%T,413%C,413%T,413%G,413-,413+A,413+T,413+G,413+A,414%A,414%C,414%T,414%T,414%A,414-,415%A,415%G,415%A,415%A,415%T,415%G,415%G,415+C,415+C,416%C,416%A,416%T,416%C,416%A,416%C,416%T,416%T,416-,416-,416+G,416+T,417%A,417%C,417%A,417%A,417%A,417%A,417%G,417%A,417%A,417+A,417+C,417+A,418%C,418%T,418%C,418%T,418%T,418%T,418%C,418%T,418%C,418%A,418%A,418%A,418-,419%A,419%C,419%A,419%A,419%A,419%C,419+C,420%A,420%C,420%A,420%A,420%C,420%A,420%A,420%T,420%A,420%A,420%C,420%C,420%T,420-,420+G,421%A,421%T,421%T,421%A,421%T,421%C,421%A,421+C,422%G,422%G,422%C,422%G,422%C,422%T,422%G,422%T,422%T,422-,422-,422-,422-,422-,423%C,423%A,423%C,423%C,423%C,423%A,423%C,423%T,423%A,423%T,423%A,423-,423-,423-,423+C,424%A,424%A,424%A,424%G,424%G,424%T,424%T,424%T,424%T,424%A,424-,424+G,425%T,425%C,425%A,425%A,425%A,425%C,425%T,425-,425-,425-,425+A,425+T,425+A,425+A,426%G,426%C,426%C,426%C,426%T,426%C,426-,426+C,426+T,427%C,427%T,427%G,427%G,427%C,427%G,427%C,427%T,427-,427+A,428%T,428%G,428%T,428%T,428%T,428%G,428%A,428%G,428%G,428%A,428%A,428%G,428%G,428%A,428%T,428-,429%G,429%C,429%G,429%C,429%C,429%T,429%G,429%T,429%G,429%G,429%G,429%C,429%C,429%C,429-,429-,429+C,430%C,430%C,430%C,430%A,430%C,430%T,430+C,430+G,431%C,431%T,431%C,431%T,431%C,431%T,431%T,431-,432%C,432%C,432%C,432%G,432%T,432%C,432%G,432%T,432%T,432%T,432%T,432%G,432-,432+A,432+G,433%C,433%G,433%C,433%G,433%G,433%A,433%A,433%C,433%G,433%G,433%G,433%C,433%A,433-,434%C,434%C,434%C,434%G,434%G,434%G,434%G,434%C,434%C,434%C,434%G,434%A,434%A,434%A,434%C,434%C,434+G,435%T,435%C,435%T,435%G,435%G,435%G,435%G,435%T,435%C,435%T,435%C,435%G,435%C,435%G,435%G,435%G,435%G,435%G,435%G,435-,435-,435+A,436%T,436%A,436%T,436%C,436%C,436%T,436%C,436%T,436%C,436%C,436%C,436%C,436%C,436%T,436%A,436%T,436%T,436-,436-,436+G,437%C,437%T,437%T,437%G,437%C,437%C,437%T,437%T,437%C,437%T,437%T,437%C,437%G,437-,437-,437+A,437+T,438%A,438%A,438%A,438%C,438%G,438%G,438%G,438%A,438-,438+A,438+T,439%T,439%T,439%G,439%C,439%T,439%T,439%G,439-,439-,439+T,439+T,439+T,440%T,440%G,440%A,440%T,440%T,440%A,440%T,440%T,440%T,440%T,440-,440+G,441%A,441%A,441%A,441%G,441%A,441%T,441%T,441%A,441%G,441%G,441%T,441%A,441%A,441%T,441%A,441-,441-,441+T,441+A,442%G,442%T,442%G,442%G,442%T,442%T,442%A,442%A,442%T,442+C,442+A,443%G,443%C,443%G,443%C,443%G,443%G,443%G,443%G,443%A,443%A,443%A,444%C,444%T,444%C,444%C,444%T,444%T,444%T,444%A,444%T,444%A,444%T,444%T,444%A,444%A,444%T,444%A,444%C,444%C,444-,444+T,444+G,445%C,445%T,445%A,445%C,445%C,445%T,445%T,445%T,445%T,445%T,445%T,445-,445-,445-,445-,445-,445+T,445+G,446%G,446%C,446%A,446%G,446%C,446-,447%C,447%T,447%C,447%G,447%G,447%T,447%C,447%C,447%C,447%C,447%T,447%T,447-,447-,448%T,448%A,448%A,448%C,448%A,448%A,448%A,448%C,448%A,448%C,448%A,448%T,448%C,448%A,448%A,448%A,448%T,448%C,448-,448+G,448+G,449%A,449%A,449%A,449%G,449%G,449%G,449%C,449%A,449%G,449%A,449%G,450%

And in there, the ID lines (after the ‘@’ ) are definetly unique. BUt throws me back the same problem. I can send you such a file if you want to try.

Thanks! -JA

Hi @Jeremie_Auger,

I’m still a bit confused as the file previously linked does not have unique identifiers. It is possible the demux summarization would work without unique identifiers whereas other steps would produce unexpected results. I recommend ensuring sequence identifiers are unique in order to avoid weird bugs.

Using a trim length of 450nt (--p-trim-length 450), it appears that 499,827 sequences (99.97% of the data) are unique. The default cluster size (--p-min-size) for Deblur is 2 meaning that a feature must be observed at least twice. If you were to use a trim of 120nt, or change the cluster size to 1, you’ll most likely see more features in the results.

The amount of singletons is high. It is possible the simulated data may not model real amplicon data from Illumina instruments or their recent chemistries appropriately.

$ funzip Mock10-Mix1.fastq.gz | sed -n '/^@/{n;p;}' | cut -c 1-450 | sort - | uniq | wc -l
  499827
$ funzip Mock10-Mix1.fastq.gz | sed -n '/^@/{n;p;}' | cut -c 1-150 | sort - | uniq | wc -l
  459553
$ funzip Mock10-Mix1.fastq.gz | sed -n '/^@/{n;p;}' | cut -c 1-120 | sort - | uniq | wc -l
  207576

All the best,
Daniel

Hi Daniel,

Thank you for your very timely and very knowledgeable answer. This observation really can explain the bug very well (about too many singletons at longer trim length).

Unfortunately, in the recent q2-dada2 implementation, --p-min-size doesn’t seem to be recognized as an option (q2-2019.7 and q2-2019.10).

Reading from the manual, I tried to find the equivalent, but no luck. I tried to turn off the chimera filtering method (with ‘–p-chimera-method none’), but no luck there either. I can send the manual printed by the function…

I am looking at more sophisticated software than ‘grinder’ for more accurate error generation. I also think that i can’t adjust error to the longer v3-v4 region. Looking at BEAR (but not a simple software!: https://github.com/sej917/BEAR/blob/master/docs/bear_user_manual.pdf )

– edit – adding a link to a working directory with the files and short version of the code.

And again, may thanks for the help. -JA

@Jeremie_Auger, you’re welcome!

Note: Deblur, not DADA2 :slight_smile: I’ll need to defer to others for interpretation of DADA2’s handling of these data.

As a heads up, it may be more appropriate to describe this as an interpretation question rather than a bug. At the moment, this thread seems to surround simulated data, which may have characteristics the algorithms were not designed for, and parameter choices for the different algorithms being explored.

1 Like

You are probably right about this post’s classification! It is not a bug but a behaviour from q2-Dada2.

I will allow myself to this one last intervention. I think I have fixed it. The ‘bug’ must have something to do with Dada’s quality models. So I wrote a bit of python to make “realistic” fastq error profiles.

grinder-fasta-to-fastq-MANUAL_ERROR.py (3.8 KB)
I join a document where I could import 400 bp rep-seqs into Dada table. The code is a bit messy as it comprises 3 parts:

  1. Software = ‘Grinder’ – To generate the fasta from the reference.
  2. Python code to ‘simulate’ error and make fastq from fastq (imports + 1 fonction + 1 loop that iterates over the sequences in the specified fastq file and writes out)
  3. Qiime2 (dada, taxonomy, etc.)

And I join a link to my working folder. It includes the files and outputs. All the code should run with some minor adjustments. You only need to keep the file “Mock10-Mix1-reads.fa” to recreate all the steps.

https://drive.google.com/drive/folders/1DKbagOOgXUUPtjcRLeb5FDi7NWAgQwxv

And thanks again,
Wishing you a great one, -JA

I have re-titled this topic to better reflect the content. I think you should be able to edit the title if you can think of a more appropriate title…