Hi @Oddant1,
I was trying to work on denoising step (a new set of samples). And it gives me following error.
I tried with solutions for OOM and didn't' work.
Looks like it is an error in dada2.
Your help is much appreciated.
- Version of QIIME 2 you are running, and how it is installed (e.g. Virtualbox, conda, etc.)
qiime2-amplicon-2024.2
Virtual Machine: WSL, Ubuntu
-
What is the exact command or commands you ran? Copy and paste please.
qiime dada2 denoise-ccs
--i-demultiplexed-seqs reads_qzaMice/raw_readsMice.qza
--p-min-len 300 --p-max-len 900
--p-front TAGAGGAAGTAAAAGTCGTAA --p-adapter TCCTCCGCTTWTTGWTWTGC
--p-n-threads 16
--o-table dada2_outputMice/tableMice.qza
--o-representative-sequences dada2_outputMice/representative_sequencesMice.qza
--o-denoising-stats dada2_outputMice/statsMice.qza
--verbose -
What is the exact error message? If you didn't run the command with the
--verboseflag, please re-run and copy-and-paste the results.
- Filtering The filter removed all reads: /tmp/tmpp726hcru/filt/sample-AR27_26_L001_R1_001.fastq.gz not written.
Some input samples had no reads pass the filter.
................x........... - Learning Error Rates
55231 total bases in 98 reads from 27 samples will be used for learning the error rates.
Error in dada(drps, err = NULL, errorEstimationFunction = errorEstimationFunction, :
Invalid derep$quals matrix. Quality values must be positive integers.
5: stop("Invalid derep$quals matrix. Quality values must be positive integers.")
4: dada(drps, err = NULL, errorEstimationFunction = errorEstimationFunction,
selfConsist = TRUE, multithread = multithread, verbose = verbose,
MAX_CONSIST = MAX_CONSIST, OMEGA_C = OMEGA_C, ...)
3: learnErrors(filts, nreads = nreads.learn, errorEstimationFunction = dada2:::PacBioErrfun,
multithread = multithread, BAND_SIZE = BAND_SIZE)
2: withCallingHandlers(expr, warning = function(w) if (inherits(w,
classes)) tryInvokeRestart("muffleWarning"))
1: suppressWarnings(learnErrors(filts, nreads = nreads.learn, errorEstimationFunction = dada2:::PacBioErrfun,
multithread = multithread, BAND_SIZE = BAND_SIZE))
Traceback (most recent call last):
File "/home/sathya/miniconda3/envs/qiime2-amplicon-2024.2/lib/python3.8/site-packages/q2_dada2/_denoise.py", line 467, in denoise_ccs
run_commands([cmd])
File "/home/sathya/miniconda3/envs/qiime2-amplicon-2024.2/lib/python3.8/site-packages/q2_dada2/_denoise.py", line 37, in run_commands
subprocess.run(cmd, check=True)
File "/home/sathya/miniconda3/envs/qiime2-amplicon-2024.2/lib/python3.8/subprocess.py", line 516, in run
raise CalledProcessError(retcode, process.args,
subprocess.CalledProcessError: Command '['run_dada.R', '--input_directory', '/tmp/qiime2/sathya/data/80d190c9-1a54-405a-b81e-bc9bf7eef3c6/data', '--output_path', '/tmp/tmpp726hcru/output.tsv.biom', '--output_track', '/tmp/tmpp726hcru/track.tsv', '--removed_primer_directory', '/tmp/tmpp726hcru/nop', '--filtered_directory', '/tmp/tmpp726hcru/filt', '--forward_primer', 'TAGAGGAAGTAAAAGTCGTAA', '--reverse_primer', 'TCCTCCGCTTWTTGWTWTGC', '--max_mismatch', '2', '--indels', 'False', '--truncation_length', '0', '--trim_left', '0', '--max_expected_errors', '2.0', '--truncation_quality_score', '2', '--min_length', '300', '--max_length', '900', '--pooling_method', 'independent', '--chimera_method', 'consensus', '--min_parental_fold', '3.5', '--allow_one_off', 'False', '--num_threads', '16', '--learn_min_reads', '1000000', '--homopolymer_gap_penalty', 'NULL', '--band_size', '32']' returned non-zero exit status 1.
During handling of the above exception, another exception occurred:
Traceback (most recent call last):
File "/home/sathya/miniconda3/envs/qiime2-amplicon-2024.2/lib/python3.8/site-packages/q2cli/commands.py", line 520, in call
results = self._execute_action(
File "/home/sathya/miniconda3/envs/qiime2-amplicon-2024.2/lib/python3.8/site-packages/q2cli/commands.py", line 581, in _execute_action
results = action(**arguments)
File "", line 2, in denoise_ccs
File "/home/sathya/miniconda3/envs/qiime2-amplicon-2024.2/lib/python3.8/site-packages/qiime2/sdk/action.py", line 342, in bound_callable
outputs = self.callable_executor(
File "/home/sathya/miniconda3/envs/qiime2-amplicon-2024.2/lib/python3.8/site-packages/qiime2/sdk/action.py", line 566, in callable_executor
output_views = self._callable(**view_args)
File "/home/sathya/miniconda3/envs/qiime2-amplicon-2024.2/lib/python3.8/site-packages/q2_dada2/_denoise.py", line 476, in denoise_ccs
raise Exception("An error was encountered while running DADA2"
Exception: An error was encountered while running DADA2 in R (return code 1), please inspect stdout and stderr to learn more.
Plugin error from dada2:
An error was encountered while running DADA2 in R (return code 1), please inspect stdout and stderr to learn more.
See above for debug info.
