Cutting ITS primer sequence produces error because of IUPAC code limitations

[esther]

Hi there,

I’m running qiime2-2020.2.

I want to trim adapters/primers from my ITS reads using this command:

qiime cutadapt trim-paired --i-demultiplexed-sequences ./paired-end-demux.qza --p-cores 6 --p-front-f GAACGCAGCRAAIIGYGA --p-front-r TCCTCCGCTTATTGATATGC --p-error-rate 0 --o-trimmed-sequences ./paired-end-demux-trimmed.qza --output-dir unspecified-trim --verbose

I get the following error:
cutadapt: error: Character ‘I’ in adapter sequence ‘GAACGCAGCRAAIIGYGA’ is not a valid IUPAC code. Use only characters XACGTURYSWKMBDHVN.

Would it be possible to allow ‘I’ as a character?
These are standard primers from JGI.

Thanks much for any advise!

[SoilRotifer (Mike Robeson)]

Hi @esther

Cutadapt can handle IUPAC, but note that I is not a standard IUPAC label. See my post here that describes what I is and how to handle it:

Handling ambiguous nucleotides in database construction

Hi @devonorourke & @Nicholas_Bokulich, I have had similar issues with I characters when using vsearch and other similar tools. Keep in mind that I stands for the chemical Inosine / deoxyInosine, which you can order as part of your oligos (e.g. from IDT). That is, it functions literally as an ambiguous N base. So, wherever you find and I replace with N. For example, take a look at the CO1 blocking primer we made in our swine diet paper. As for the U --> T bit… In the past, when I put that set o…

-Best wishes!
-Mike

[esther]

Perfect, thanks so much for the quick reply, Mike!!

This worked