Cutting ITS primer sequence produces error because of IUPAC code limitations

Hi there,

I'm running qiime2-2020.2.

I want to trim adapters/primers from my ITS reads using this command:

qiime cutadapt trim-paired --i-demultiplexed-sequences ./paired-end-demux.qza --p-cores 6 --p-front-f GAACGCAGCRAAIIGYGA --p-front-r TCCTCCGCTTATTGATATGC --p-error-rate 0 --o-trimmed-sequences ./paired-end-demux-trimmed.qza --output-dir unspecified-trim --verbose

I get the following error:
cutadapt: error: Character 'I' in adapter sequence 'GAACGCAGCRAAIIGYGA' is not a valid IUPAC code. Use only characters XACGTURYSWKMBDHVN.

Would it be possible to allow 'I' as a character?
These are standard primers from JGI.

Thanks much for any advise!

Hi @esther

Cutadapt can handle IUPAC, but note that I is not a standard IUPAC label. See my post here that describes what I is and how to handle it:

-Best wishes!
-Mike

Perfect, thanks so much for the quick reply, Mike!!

This worked :slight_smile: