esther
April 27, 2020, 7:03pm
1
Hi there,
I'm running qiime2-2020.2.
I want to trim adapters/primers from my ITS reads using this command:
qiime cutadapt trim-paired --i-demultiplexed-sequences ./paired-end-demux.qza --p-cores 6 --p-front-f GAACGCAGCRAAIIGYGA --p-front-r TCCTCCGCTTATTGATATGC --p-error-rate 0 --o-trimmed-sequences ./paired-end-demux-trimmed.qza --output-dir unspecified-trim --verbose
I get the following error:
cutadapt: error: Character 'I' in adapter sequence 'GAACGCAGCRAAIIGYGA' is not a valid IUPAC code. Use only characters XACGTURYSWKMBDHVN.
Would it be possible to allow 'I' as a character?
These are standard primers from JGI.
Thanks much for any advise!
Hi @esther
Cutadapt can handle IUPAC, but note that I is not a standard IUPAC label. See my post here that describes what I is and how to handle it:
Hi @devonorourke & @Nicholas_Bokulich ,
I have had similar issues with I characters when using vsearch and other similar tools. Keep in mind that I stands for the chemical Inosine / deoxyInosine, which you can order as part of your oligos (e.g. from IDT ). That is, it functions literally as an ambiguous N base. So, wherever you find and I replace with N. For example, take a look at the CO1 blocking primer we made in our swine diet paper .
As for the U --> T bit... In the past, when I put that set…
-Best wishes!
-Mike
esther
April 27, 2020, 7:54pm
5
Perfect, thanks so much for the quick reply, Mike!!
This worked