What's wrong with cutadapt about " Missing option: --i-demultiplexed-sequences"

[YuZhang]

Hello,friends.
I'm a freshman to the QIIME2. I have some trouble in using cutadapt. I aim to remove my barcode and primer in my sequences of my 16s dada.
I already impot my dada in qiime2，like below：
qiime demux summarize
--i-data demux.qza
--o-visualization demux.qzv

And I want to use this：
qiime cutadapt trim-paired
--i-demultiplexed-sequences demux.qza
--p-front-f ACTCCTACGGGAGGCAGCAG
--p-front-r GGACTACHVGGGTWTCTAAT
--p-match-adapter-wildcards
--p-match-read-wildcards
--p-discard-untrimmed
--o-trimmed-sequences paired-end-demux-trimmed.qza

to remove primers.

But, something was wrong

I don't know how to deal with that.
Please tell me what can I do.

[cherman2 (Chloe Herman)]

Hello @YuZhang,
Welcome to QIIME2. Thank you for providing a lot of information so that I can help
I think for some reason the commands got separated and qiime didn’t understand what you were trying to do. In the first screen shot, there is no inputs following the “qiime cutadapt trim-paired”. And In the second screen shot, there is no “qiime cutadapt trim-paired” before you list your inputs, parameter, and outputs.

This should be one command:
qiime cutadapt trim-paired \
–i-demultiplexed-sequences demux.qza \
–p-front-f ACTCCTACGGGAGGCAGCAG \
–p-front-r GGACTACHVGGGTWTCTAAT \
–p-match-adapter-wildcards \
–p-match-read-wildcards \
–p-discard-untrimmed \
–o-trimmed-sequences paired-end-demux-trimmed.qza

Make sure there is no weird spacing that is effecting it and you should be good to go!

I hope this helps!
Chloe

[YuZhang]

Thanks for your very kind help. So I tried it.

I inputed:
qiime cutadapt trim-paired
--i-demultiplexed-sequences demux.qza
--p-front-f ACTCCTACGGGAGGCAGCAG
--p-front-r GGACTACHVGGGTWTCTAAT
--p-match-adapter-wildcards
--p-match-read-wildcards
--p-discard-untrimmed
--o-trimmed-sequences paired-end-demux-trimmed.qza

But some thing went wrong, like this

I search the "cutadapt", it does have the option.

So,what‘wrong？

[cherman2 (Chloe Herman)]

Hello @YuZhang,
I am glad we were able to solve your first problem!

I believe the reason you are getting an error, "no such option: --p-discard-untrimmed" is because of the version of QIIME you are using . You are using 2018.11, if you look at the documentation for qiime cutadapt trim-paired for the 2018.11 version there is no parameter called --p-discard-untrimmed (This was added in version 2019.4).

There are two solutions to this problem, decide whether or not you need to discard untrimmed, or download the latest version of QIIME (it just was released yesterday! ). I recommend downloading the latest version of QIIME and you should be golden.

Hope that helps!
Chloe

[YuZhang]

You are very nice.
Thanks again!