reverse primer sequence strand for 'qiime feature-classifier extract-reads' (rescript)

Dear

I am a bit confused, the 'qiime feature-classifier extract-reads' inline help tells us not to use rc sequences for the reverse primer

  --p-r-primer TEXT       reverse primer sequence (5' -> 3'). Do not use
                          reverse-complemented primer sequence.     [required]

but the tutorial page seems to use the rc sequence for 806R (unless I am confusing strands)

--p-r-primer GGACTACNVGGGTWTCTAAT

What do we need to take for the reverse primer?
Thanks

Hi @splaisan,

I think that is the case. According to the EMP 16S protocol (from which these primer sequences are taken), these are the correct forward primer sequences, not the RC.

Then we do not mean the same by reverse primer.

the page you cite gives this:

#### 806R reverse primer

Field descriptions (space-delimited):

1. Reverse complement of 3′ Illumina adapter
2. Reverse primer pad
3. Reverse primer linker
4. Reverse primer (806R)

`CAAGCAGAAGACGGCATACGAGAT AGTCAGCCAG CC GGACTACNVGGGTWTCTAAT`

where the same sequence is called 'Reverse primer (806R)' so not a forward sequence as you would read on the template DNA (5'-ATTAGA...AGTCC-3').

But again I may be wrong.

My point is that the help seems to suggest that one should give the top strand sequence for the reverse primer in the direction 5'->3' of the template DNA instead of the sequence of the primer as ordered to the oligo provider.

Hi @splaisan,

The action qiime feature-classifier extract-reads will reverse compliment the reverse primer for you. If you work through the tutorial, and inspect the output, you'll see that the command will work as intended.

By standardizing the entry of primer sequences in the 5'-3' direction, the user can simply copy and paste the primer sequence that they ordered without risk incorrectly reverse complimenting the reverse primer.

As was already discussed, users can simply copy and paste the primer sequence from the EMP 16S Protocol page, and be done with it.

-Mike

@splaisan, I've added the following text to the tutorial. Thank for pointing out that ambiguity! :slight_smile:

Here, you'll use the same primer sequences that you used for your PCR / sequencing, to extract the amplicon region from our reference database. Note, we enter the primer sequences in the 5'-3' direction, i.e. as you would order the oligos from a vendor.

thanks Mike, put like this it is cristal clear.