Qiime tools import missing one or more files

Good day

Please help, i ran qiime tools import --type SampleData[PairedEndSequencesWithQuality] --input-path /scratch/sysusers/kedibone/reanalysis --output-path emp-paired-end-sequences.qza

and I got this error, missing one or more files for SingleLanePerSamplePairedEndFastqDirFmt: 'MANIFEST'

Hi @kedi,
Thanks for posting!

You should check out the data importing tutorials here. In particular, see the section on fastq manifest formats and casava8 format— you will either need to provide a manifest file to map your sample identifiers or specify the source type if you plan to use a different importing scheme. By default, the importer is assuming that you are following the manifest format but you have not provided a manifest file to this command.

I hope that helps!

Hi Nicholas

Thanks for your prompt reply, I am working on my own dataset and the data is already in my working directory any idea as to how i should convert them in the required formats? Please advise.

Kedi

Hi @kedi,
The import method will depend mostly on how your samples were prepared and sequenced. Please read those tutorials first to determine what works for the formats that you have (you probably don't need to convert anything, you just need to determine whether your sequences are in a single file or one file per sample)

If you are still having trouble, could you please share the following:

  1. the output of ls /scratch/sysusers/kedibone/reanalysis
  2. what do your sequences look like? Could you show me the first few lines of an example sequence file and an example barcode file? (e.g., if your file is file.fastq, use head file.fastq. If it ends in .gz, use gunzip file.fastq.gz | head)
  3. what library prep and sequencing protocol did you use?

Thanks!

Hi Nicholas

Thanks for your prompt response

  1. (qiime2-2017.12) [kedibone@cn01 reanalysis]$ ls
    A11_S5_L001_R1_001.fastq C3_S10_L001_R1_001.fastq.gz E7_S26_L001_R1_001.fastq.gz
    A11_S5_L001_R2_001.fastq.gz C3_S10_L001_R2_001.fastq.gz E7_S26_L001_R2_001.fastq.gz
    A12_S6_L001_R1_001.fastq.gz C5_S11_L001_R1_001.fastq.gz F2_S29_L001_R1_001.fastq.gz
    A12_S6_L001_R2_001.fastq.gz C5_S11_L001_R2_001.fastq.gz F2_S29_L001_R2_001.fastq.gz
    A2B_S47_L001_R1_001.fastq.gz C6_S12_L001_R1_001.fastq.gz F4_S30_L001_R1_001.fastq.gz
    A2B_S47_L001_R2_001.fastq.gz C6_S12_L001_R2_001.fastq.gz F4_S30_L001_R2_001.fastq.gz
    A2_S1_L001_R1_001.fastq.gz C7_S13_L001_R1_001.fastq.gz F6_S33_L001_R1_001.fastq.gz
    A2_S1_L001_R2_001.fastq.gz C7_S13_L001_R2_001.fastq.gz F6_S33_L001_R2_001.fastq.gz
    a3_S8_L001_R1_001.fastq.gz C9_S14_L001_R1_001.fastq.gz G10_S39_L001_R1_001.fastq.gz
    a3_S8_L001_R2_001.fastq.gz C9_S14_L001_R2_001.fastq.gz G10_S39_L001_R2_001.fastq.gz
    A5_S49_L001_R1_001.fastq.gz D11_S21_L001_R1_001.fastq.gz G4_S34_L001_R1_001.fastq.gz
    A5_S49_L001_R2_001.fastq.gz D11_S21_L001_R2_001.fastq.gz G4_S34_L001_R2_001.fastq.gz
    A8B_S4_L001_R1_001.fastq.gz D12_S22_L001_R1_001.fastq.gz G6_S35_L001_R1_001.fastq.gz
    2 The sequences are demultiplexed already
    @M01232:36:000000000-AN97M:1:1101:18368:1178 1:N:0:5
    CCTACGGGCGGCTGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGCCCTCGGGTCGTAAAGCACTTTAAGTTGGGAGGAAGGGCTTACAGCGAATACCTGTGAGTTTTGACGTTACCAACAGAATAAGCACCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGCTTGATAAGTTGGATGTGAAATCCCCGGGCTCAACCTGNGAACTGCATCCAAA

BCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGFEFFGEEFEGFGDDGFGGGGGFGFGGDECGGGGFGGGGGGBFGFGGGGGGGFGGGGGGGGGGGGGGGGFGGGGDEFGGFGGCCCCGEGGGGGGGGGGG=E=8EFFG8EGGDBFEEGGGGFGGGF(97C8EG275@;B54DC5>843FD@7?FFF>F;73,8<??FD70+CG=C0(7<??80;#247506)8*+<4CF
3. MiSeq flow cell for a 2 × 300 paired-end sequencing
thanks in advance

Hi @kedi,
It looks like your data are CASAVA 1.8 paired-end reads. You should be able to import your data following the instructions here.

I hope that helps!

Thanks Nicholas. Managed to run it.