QIIME Metadata how to fill correctly the Barcode Id and the Primer sequence

[Benard (Oloo)]

I just want to know how to organise the 1): BarcodeID column of my metadata file given that I have 2 Indices (red and White) and 2): PrimerLinkerSequence column; given I used reverse and forward primers of 50 nucleotides each?

[thermokarst]

Hi there @Benard!

QIIME 2 doesn’t have any required metadata columns (this is different that the situation in QIIME 1). You can learn more by checking out the Metadata in QIIME 2 tutorial.

I have a few questions though about what you are trying to ultimately accomplish here. Are the “red” and “white” barcodes part of some kind of dual-indexing scheme? If so, we don’t have any plugins or methods in Q2 to support demultiplexing these kinds of data (yet).

As for the linker primer, you can use cutadapt trim-paired or cutadapt trim-single to remove the primers, no metadata necessary - you just pass in the primer string you wish to search for and remove.

Keep us posted!

[Benard (Oloo)]

Thanks Mathew for your feedback. First, I realize am on the wrong forum. We only have QIIME 1.8/1.9 installed. Second, the red and white are dual indices. Hence as you say, may be QIIME 1 is my best bet. In this case, the linker primers, the QIIME 1 pipeline template am working with has it as a key column of the meta data. Since I used Forward and Reverse Primers, may be I join the two with a comma! So may be this means I move to QIIME 1 forum?

Thanks again, Sir, much appreciated. Since I am just getting trained in Bio-Informatics and command lines, I welcome best practice ideas.

[Benard (Oloo)]

Here is the kind of error I am getting:
Errors and warnings are written as a tab separated columns, with the first column showing the error or warning, and the second column contains the location of the error or warning, written as row,column, where 0,0 is the top left header item (SampleID). Problems not specific to a particular data cell will be listed as having ‘no location’.
Errors -----------------------------
Invalid DNA sequence detected: “TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGNWGCAG,GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATACC” 1,2
Invalid DNA sequence detected: "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGNWGCAG,GTCTCGTGGGCTCGGAGATGTGTATAAGAG
These are oligonucleotides from Bioneer Primers: Since these primers were used for all the samples, I just repeated them through out the meta data file.
Here is the command I ran:$ validate_mapping_file.py -m Pool1Metadata.txt -o validate_meta
Thanks,

Ben.

[thermokarst]

Hi there @Benard - I moved this topic over to Other Bioinformatics Tools, since this question is not related to QIIME 2. We aren’t able to provide support on this forum for QIIME 1, but maybe someone will peek in and offer some advice. As well, it is worth noting the QIIME 2 officially succeeded QIIME 1 at the start of 2018, and as such there is no longer any official support or maintenance of QIIME 1. We recommend you take a look at the QIIME 2 Getting Started Guide to get geared up with QIIME 2. If you have any questions, well, now you know where to find us!