qiime feature-classifier running for very long "qiime2-2019.4"

Dear Friends,

I am running this command:

qiime feature-classifier extract-reads --i-sequences gg_13_5.qza --p-f-primer AGAGTTTGATCCTGGCTCAG --p-r-primer ACGGCTACCTTGTTACGACTT --o-reads gg_13_5_ww_DNA_1to11_paired_ref_seq.qza --verbose

It's been running for an hour now. I was expecting that with qiime2-2019.4 this step will be faster. Can you please let me know if this is normal? Or, if there is any way to speed up this step? Thanks!

unfortunately this is a slow step. be patient, it will finish!