q2-cutadapt question

Hello
Sequencing in illumina.
I need to delete the universal adapter.
Paired-end fastq file.
read1: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
read2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
How can I remove it?
Thank you.

Hello @shinseung

I think q2-cutadapt is the right plugin to use!

Take a look at all the settings here, and see if you can figure out the command to run: https://docs.qiime2.org/2019.10/plugins/available/cutadapt/trim-paired/

Let us know if you have any questions!

Colin

Thanks for the answer, I've run q2_cutadapt. Looking at the log file.
I don't know how to view the log file.
Was it deleted?

Thank you.

Yes, Qiime 2 can remove temporary files after running a command. I’m not sure what log files are kept.

Based on the log file you showed me, do you think cutadapt worked as intended?

Colin

This topic was automatically closed 31 days after the last reply. New replies are no longer allowed.