q2-cutadapt question

Hello
Sequencing in illumina.
I need to delete the universal adapter.
Paired-end fastq file.
read1: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
read2: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
How can I remove it?
Thank you.

Hello @shinseung

I think q2-cutadapt is the right plugin to use!

Take a look at all the settings here, and see if you can figure out the command to run: https://docs.qiime2.org/2019.10/plugins/available/cutadapt/trim-paired/

Let us know if you have any questions!

Colin

Thanks for the answer, I’ve run q2_cutadapt. Looking at the log file.
I don’t know how to view the log file.
Was it deleted?

Thank you.

Yes, Qiime 2 can remove temporary files after running a command. I’m not sure what log files are kept.

Based on the log file you showed me, do you think cutadapt worked as intended?

Colin