Primers & adapters missing

Hello everyone,

I am new to Q2, I am looking at a 16s dataset, and supposedly the samples are barcoded from one end with a 515(f) primer, but I cannot find them when I look through my Fastq files. I talked to my advisor, and they said that they should be there, but I do not see them.

(Background) I turned my fastq files from a txt into a pdf, and I have been control-searching for the primers. Instead of GTGYCAGCMGCCGCGGTAA, I keep getting CCTGTTTGCTCCCCACGCTTTCG as the introductory sequence. I do not recognize this as a primer, though? Should I manually trim that anyway or go straight from demux sequences to denoising? Also, when I tried to use cutadapt, I got zero reads on my summary with adapters. That is what prompted my confusion.

For now, I can run the rest of my steps without trimming. I just do not want to get far and then realize I missed the primer! I would also like to get past this step soon so I can get to the fun part! Any advice would be great. :slight_smile:

Best,
Maya

Hi @mayalmp, welcome to :qiime2:!

So what sequencing strategy was used to generate the data? For example, if you are using the sequencing strategy as outlined via the Earth Microbiome 16S rRNA gene Protocol then there may not be any primers in the generated sequence data.

More details can be found here:

-Mike

Hey Mike,

Sorry for the late reply! I thought it would take longer for my post to submit (first time user).

Yeah, the dataset I am looking at is from another lab, so I am not sure what steps they took to create it, but I will look over the Earth Microbiome Protocol! All I was given was the feature table with the sequence ID, barcode, R1(515) Primer, & metadata, and the fastq files. Like I said before (in theory) there should be one primer attached to the forward read? But I really think that they cut adapted it before I got a hold of it.

Looking at the other persons run (thank you for the link!) it seams like my primers have been cut out since none of the primers or adapters showed up in my R1 or R2 cut adapt summary, and my lowest quality score is 30 on the R2 so I feel like that's not the issue. I also ran Dada2 on the Demuxed reads and they paired fine, so I'm hoping that its just that the primers were already cut out haha

I have a lab meeting this coming Monday, so here is hoping that I am doing this right?
This made me feel a lot better about my hunch though, thank you!!!! :smile:

Best,
Maya