I’m following tutorial for Clustering sequences into OTUs using q2-vsearch. When I tray to perform dereplicate-sequences command with this line of code:
Plugin error from vsearch:
Command ‘[‘vsearch’, ‘–derep_fulllength’, ‘/tmp/qiime2-archive-0i4ewa1i/5425ffd8-a47c-4073-a017-9c39c0a0ec51/data/seqs.fna’, ‘–output’, ‘/tmp/q2-DNAFASTAFormat-pykd64oq’, ‘–relabel_sha1’, ‘–relabel_keep’, ‘–uc’, ‘/tmp/tmp_j020ps3’, ‘–qmask’, ‘none’, ‘–xsize’]’ returned non-zero exit status 1
Debug info has been saved to /tmp/qiime2-q2cli-err-phd5l6x4.log
I’m not sure how to fix it?
The version of Qiime is 2018.11 instaled via Docker.
This is the result:
Error response from daemon: error while creating mount source path ‘/host_mnt/d/qiime2-vm/microbes-20181115T140850Z-001/microbes/data_download’: mkdir /host_mnt/d: file exists.
Hi @Mirjana - that is a new and different error than what you originally posted, related to Docker (looks like something to do with Docker on windows and your mounted volume). Your QIIME 2 command didn’t even get a chance to run, the error happened before QIIME 2 even had a chance to launch.
Yes, it was error related to Docker. I fix it by restarting credentials in Docker.
Now when I re-run with the --verbos like this:
docker run -t -i -v D:\qiime2-vm\microbes-20181115T140850Z-001\microbes\data_download:/data qiime2/core:2018.11
qiime vsearch dereplicate-sequences
–verbose
–i-sequences mphm_test.qza
–o-dereplicated-table table.qza
–o-dereplicated-sequences rep-seqs.qza
The new error is:
Fatal error: illegal character ‘.’ on line 991590 in FASTA file
Traceback (most recent call last):
File “/opt/conda/envs/qiime2-2018.11/lib/python3.5/site-packages/q2cli/commands.py”, line 274, in call
results = action(**arguments)
File “”, line 2, in dereplicate_sequences
File “/opt/conda/envs/qiime2-2018.11/lib/python3.5/site-packages/qiime2/sdk/action.py”, line 231, in bound_callable
output_types, provenance)
File “/opt/conda/envs/qiime2-2018.11/lib/python3.5/site-packages/qiime2/sdk/action.py”, line 362, in callable_executor
output_views = self._callable(**view_args)
File "/opt/conda/envs/qiime2-2018.11/lib/python3.5/site-packages/q2_vsearch/cluster_sequences.py", line 132, in dereplicate_sequences
run_command(cmd)
File "/opt/conda/envs/qiime2-2018.11/lib/python3.5/site-packages/q2_vsearch/cluster_features.py", line 33, in run_command
subprocess.run(cmd, check=True)
File “/opt/conda/envs/qiime2-2018.11/lib/python3.5/subprocess.py”, line 398, in run
output=stdout, stderr=stderr)
subprocess.CalledProcessError: Command '[‘vsearch’, ‘–derep_fulllength’, ‘/tmp/qiime2-archive-fvt_0li6/5425ffd8-a47c-4073-a017-9c39c0a0ec51/data/seqs.fna’, ‘–output’, ‘/tmp/q2-DNAFASTAFormat-s5dhk7ah’, ‘–relabel_sha1’, ‘–relabel_keep’, ‘–uc’, '/tmp/tmpp8no5p’, ‘–qmask’, ‘none’, ‘–xsize’]’ returned non-zero exit status 1
@Mirjana a '.' character is sometimes used to indicate a gap (instead of the '-') character. Make sure you do not have aligned sequences in your fasta file.
One of my .fna file look like this (just a part of it):
L1S1.275106_346 HWI-EAS440_0386:1:25:2733:1495#0
TACGTATGGAGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTACGCAGGCGGTTTAATAAGTCGAATGTTAAAGATCGGGGCTCAACCCCGTAAAGCATTGGAAACTGATAAACTTGAGTAGTGGAGAGGAAAGTGGAATTCCT
So I merge all of my .fna files to get mphm_test.fna.
I deleted line with illegal character '.', but then I get the same error for other line.
Sounds like you should try and get your hands on the unaligned sequences, if possible. Better yet, FASTQ would be best, giving you the most downstream processing options!