Plugin error from taxa: Feature IDs found in the table are missing from the taxonomy

Hello people of the forms,

I am learning how to train my own classifer. Thus far, i believe I have done relatively well. I am able to generate a taxonomy.gzv file that with similar species identifications I obtained from BLAST of rep-seq.qzv files. However, when I try to make a taxa box plot with the following code:

qiime taxa barplot
--i-table feature-frequency-filtered-table.qza
--i-taxonomy taxonomy.qza
--m-metadata-file DF_esg_16s_Metadata.tsv
--o-visualization taxa-bar-plots.qzv

I am met with the following error. "Plugin error from taxa:

Feature IDs found in the table are missing from the taxonomy: {'a00fcda8b9ab600673e0beeebf15b50f' etc"

I would really appreciate any guidance on the subject. Cheers.

Here is the code I used leading up this point:

4.2 Obtain and import reference sequences
qiime tools import
--type 'FeatureData[Sequence]'
--input-path 99_otus.fasta
--output-path 99_otus.qza

qiime tools import
--type 'FeatureData[Taxonomy]'
--input-format HeaderlessTSVTaxonomyFormat
--input-path 99_otu_taxonomy.txt
--output-path ref-taxonomy.qza

4.3 Extract your reference sequences
qiime feature-classifier extract-reads
--i-sequences 99_otus.qza
--p-f-primer AGAGTTTGATCCTGGCTCAG
--p-r-primer GGCTACCTTGTTACGACTT
--p-min-length 200
--p-max-length 450
--o-reads ref-seqs.qza

4.4 Train your classifier
qiime feature-classifier fit-classifier-naive-bayes
--i-reference-reads ref-seqs.qza
--i-reference-taxonomy ref-taxonomy.qza
--o-classifier classifier.qza

4.5 Test the classifier
qiime feature-classifier classify-sklearn
--i-classifier classifier.qza
--i-reads feature-frequency-filtered-rep-seqs.qza
--p-read-orientation 'same'
--o-classification taxonomy.qza

qiime metadata tabulate
--m-input-file taxonomy.qza
--o-visualization taxonomy.qzv

Hi @dfast,

First of all, welcome in the forum!

Given your error, I would focus to look more into the way you filtered your data to obtain the 'feature-frequency-filtered-table.qza' and especially 'feature-frequency-filtered-rep-seqs.qza'. How did you get those?

For the taxa-barplot, you could try to get the taxonomy for the unfiltered set and use this instead 'feature-frequency-filtered-rep-seqs.qza'. The taxa barplot plug-in should not be bothered to have more feature in the taxonomy qza file than the specified abundance qza file (this will be used as filter behind the scene).

For other analyses, I would first double check that the 'feature-frequency-filtered-table.qza' and 'feature-frequency-filtered-rep-seqs.qza' contain the same features!

Hope it helps!
Cheers!

Hi Luca,

Thank you for the welcome, and thank you very much for your recommendations. As it turns out, you were indeed correct. It was an issue regarding my filtering. I restarted the filtering process (I was trying to filter out low frequency reads) I believe the error I made was in not filtering the rep-seqs to match that of the table.
Once I reconstructed those artifacts I was able to generate a successful bar plot. Thanks very much for your help.