Plugin error from cutadapt: no space left on device

Please read the following before posting!


Hello ,
I have been trying to trim the adapter sequences from my Illumina .qza file using cutadapt as shown in the attached file. But I keep having this weird error which says 'Plugin error from cutadapt: no space left on device'.
I ran the command 'du' and also 'df -h' to check for the available space in temp, but I'm not really sure if am out of space or not. I would appreciate your


advice on this.
Thank you.
Muhammad

Good morning Muhammad,

You are on the right track here: there is an issue with file storage space and du and df -h are the perfect ways to check on files sides and spaces on your drives.

Are you running this on a server / supercomputer? If so, this may be a good question to bring to your admin or HPC team, because they will know where space is available and can help you save your files to the proper place. I know that disk access can be different on worker nodes, and I bet using the proper path will fix this problem.

Let us know what your hear from your HPC team!

Thank you very much Colin for the quick response. I am using the cloud server provided by the school via Putty. I have been allocated two different Research data storage (RDS) paths for my work. One of them is almost which made me switch to the second which has a good amount of space left, but I still get the same error. As you advised I will contact them concerning this and get back to you for updates.
Regards
Muhammad

OK good! Once you hear back from them about RDS paths and config, let us know if you need any help getting Qiime2 to use these paths.

For example, it may be helpful to set a TMPDIR environment variable as discussed here.

Good evening Collin,
I checked with my school IT service about my storage space, but I'm yet to receive any feedback. so I decided to run cutadapt the traditional way instead of going through qiime. But after running the code as seen in the picture below, i received a warning message that says: WARNING:
One or more of your adapter sequences may be incomplete.
Please see the detailed output above.
I have gone through the sequence against but every base pair seems to be correct.
I decided to do a fastq check on the trimmed sequence from the cutadapt output to compare with the original untrimmed sequence. I realised only about 25% of the adapter sequence was removed which correlates with the summary result in the command line. I also run a quality check again to see how the adapter compares with the untrimmed sequence. I also see a 25% reduction in the amount of adapter sequence per bp position. is it that the adapter sequence i used wasn't actually complete? I look forward to your answers. Thank you



Hello!

OK. While we wait to hear back from IT service, let's see if we can learn from the FastQC output.

For my own notes, here's the FastQC docs, and detailed about each one of those quality analysis modules.

I agree. We have an issue with adapter sequences. While trimming seemed to remove ~25% of adapters, the FastQC report is still showing 25% with Illumina Universal Adapters after trimming, and that matches the 47% of reads with Illumina Universal Adapters before trimming.

Can you also post the Sequence Length Distribution from the joined data? I'm worried that this looks a lot like Small RNA with read-through adapter.


What region did you amplify and how long are the expected PCR products? With your 300 bp Illumina paired end reads, how much overlap would that create?

I ask because one reason we might see a bunch of adapters is if we have >100% overlap, which can be OK if we process the data correctly!


Dear Collin,
Thank you for your marvellous response.
Can you also post the sequence length distribution from the joined data?
I have attached a file showing the sequence distribution of the combined trimmed data. from my observation, after trimming the adapters, the reports gave a fail for sequence distribution length compared to a pass for the untrimmed combined data (second file). could this scenario be a result of the incomplete adapter sequence used, leading to filtering of the preceding bps?
what region did you amplify and ow long are the expected PCR products?
The DNA region amplified was the V1 region with an expected PCR product of 300-350bp.
How much overlap would you expect?
I expect an overlap of 100-150bp for this.
Thank you once again for your help.

We are making good progress! That sequence length distribution is revealing.

After joining, reads are ~300 bp long.
After joining and trimming, reads are 300 bp or ~30 bp long.

I think 30 bp is an important clue, because that's the length of the 16S V1 region.

Chakravorty 2007 claims

The nine hypervariable regions spanned nucleotides 69-99, 137-242, 433-497, 576-682, 822-879, 986-1043, 1117-1173, 1243-1294 and 1435-1465 for V1 through V9 respectively

Can we double check on which primers were used for PCR? If 300 bp paired end reads were used to sequence a 30 bp region, joining would create complete overlap.

R1                            |------------------------------>
R2 <------------------------------|
16V V1                        |---|
   <~~~~~~~~~~~~~~~~~~~~~~~~~~|---|~~~~~~~~~~~~~~~~~~~~~~~~~~> adapters

We would get different results for a V1-V2 or V1-V3, which is why I wanted to double check.

Hello Collin,
from my record, I used the primers:27F and 338R for the PCR.
Thank you

The primers used for the first pcr are –

16S_27 350 ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNAGAGTTTGATCMTGGCTCAG
16S_338 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTGCTGCCTCCCGTAGGAG

The 2nd PCR then targets the green region.
A 2nd PCR set of primers is here –

I7 - CAAGCAGAAGACGGCATACGAGATGACACAGTGTGACTGGAGTTCAGACGTGTGCTC
I5 - AATGATACGGCGACCACCGAGATCTACACGACACAGTACACTCTTTCCCTACACGACGCTC
Green is the adapter, which should be the priming sequence for the sequencing read. Red is the index, blue is the universal tail that targets the 1st PCR product.

I7 should be the forward read.
I5 should be the reverse read
Unfortunately, i don't know how to highlight the colours from here, as this was copied from my doc.

Hello again, Muhammad,

Try this. Use a the ` symbol (to the left of the 1 key on the keyboard with a ~ on it) to make a code block

```text

like this. That will make your text line up so that you can annotate regions.

16S_27	350	ACACTCTTTCCCTACACGACGC
section 1   ^^^^^
linker           ^^
section 2          ^^^^^^^^

Or post a screenshot! :framed_picture:

Hello Collin,
I really appreciate your time and support. below is a screen shot of the primer sequence and the indices used:

I used these adapters sequence in trimming, but it didn't work. Could there be a need for me to identify the reverse complement of these adapters? am confused as these sequences doesn't work

Hey Muhammad,

Luca noticed this, and I'm wondering if this is part of the issue.

Why is com.fastq.gz passed twice?

Hi Colin,
Thank you for this. I have many fastq files which I combined into a single gz file. Because the file consists of both forward and reverse reads I thought it's ok if include com.fq.gz twice as the input file.



I have concatenated the forward and reverse of the individual samples. I tried to trim the adapters using the Illumina universal primer sequence, but only few per cent of the reads was trimmed as you can see from the pic. from read1, in the column for overrepresented sequences, there was a hit for three of the sequence. I repeated the trimming using 'CTGTCTCTTATACACATCT' for trimming. still no difference.





Hi Colin,
I was able to remove the adpaters finally from my reads. I used this sequence f-AGATCGGAAGAGCACACGTCTGAACTCCAGTCA, r-
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
. If you have a look at the pictures you will these problem has been solved. thank you for your time and assistance.