Nextera adapters not removed

Hello,

I am trying to analyze 16s Illumina V3/V4 Miseq Data. They are already demultiplex the primers are already removed.
But I double check to see if the overhang adapters are also removed and I can still find them in my fastq-File (in about 5-20 sequences per fastq-File). (I checked only a few of my fastq files.)
So far, I only found the forward overhang adapter - but I didn't find them right at the beginning, sometimes some bp into the sequence.

These are the adapters:
Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐[locusspecific

sequence]

Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locusspecific

sequence]

My question is: Will the cutadadpt command also remove these if the adapter is located somewhere in the middle of the sequence?

Thanks in advance!

Hi @e_flat_minor,

The cutadapt trim-paired command should basically do what you want out of the box. (You would need to provide an anchoring character to your adapter sequence in the event you wanted it be fixed at the start.)