Importing pairend multiplexed sample with barcode data in .tsv format

Hi, I am new to QIIME.
I have two sequenced files, Fungi_F.fastq.gz and Fungi_R.fastq.gz, consisting of sequences from 48 samples and their eight replicates multiplexed, which I received from the sequencing facility. Additionally, I have a tag file containing 384 tags and associated forward and reverse primers used in each of the sample replicates.
I found the tutorials on importing multiplexed paired-end FASTQ files, which require a tag file in FASTQ format. However, I could not find any readings on importing multiplexed paired-end sequences with a tag file in TSV format. I would appreciate it if someone could guide me on how to import this type of data.
Alternatively, is there any way I can convert my tag file into FASTQ format? If so, what information do I need to include in this FASTQ file?

Hello Bish,

Welcome to the forums! :qiime2:

Can you post this tag file?

I suspect this is very similar to a format on the Importing Data page, so we can convert it for use with Qiime2.

Thank you so much, here is some portion of the tagfile I am using

Column 1 Column 2 Column 3 Column 4
EG17_L101_F_Rep_01 AACAAGCC GGAAGTAAAAGTCGTAACAAGG CCAAGAGATCCGTTGYTGAAAGT
EG17_L137_F_Rep_01 GGAATGAG GGAAGTAAAAGTCGTAACAAGG CCAAGAGATCCGTTGYTGAAAGT
EG17_L059_F_Rep_01 AATTGCCG GGAAGTAAAAGTCGTAACAAGG CCAAGAGATCCGTTGYTGAAAGT
EG17_C001_F_Rep_01 CGACCATA GGAAGTAAAAGTCGTAACAAGG CCAAGAGATCCGTTGYTGAAAGT
EG17_L239_F_Rep_01 ATGCTGAC GGAAGTAAAAGTCGTAACAAGG CCAAGAGATCCGTTGYTGAAAGT
EG17_L087_F_Rep_01 TGAGACAG GGAAGTAAAAGTCGTAACAAGG CCAAGAGATCCGTTGYTGAAAGT
EG17_L109_F_Rep_01 GAGCTTAC GGAAGTAAAAGTCGTAACAAGG CCAAGAGATCCGTTGYTGAAAGT
EG17_TS251_F_Rep_01 TTACCAGG GGAAGTAAAAGTCGTAACAAGG CCAAGAGATCCGTTGYTGAAAGT
EG17_L179_F_Rep_01 TGAGAGCT GGAAGTAAAAGTCGTAACAAGG CCAAGAGATCCGTTGYTGAAAGT
EG17_L001_F_Rep_01 CTGACCTT GGAAGTAAAAGTCGTAACAAGG CCAAGAGATCCGTTGYTGAAAGT

Okay!

Column 1 looks like sample IDs. Is that right?
Column 2 has unique identifies and is probably a barcode.
Looks like Columns 3 and 4 are the same. Probably primer or linker-primer sequences.

Am I close? You probably know more about this file than I do!

This seems like this format, with that 'tag file' being your 'metadata
https://docs.qiime2.org/2024.5/tutorials/importing/#multiplexed-paired-end-fastq-with-barcodes-in-sequence

See if you can get that working!

This could also work with cutadapt, I think. demux-paired: Demultiplex paired-end sequence data with barcodes in-sequence. — QIIME 2 2024.5.0 documentation

Let us know what you try next and how it goes! We are happy to help you work through this.

2 Likes

Sorry I could have clarified earlier. Yes, you are right, column 1 is sample ID. column 2 the barcode tags and third and fourth are forward and reverse primer sequences. I will try following your suggestion and come back in case of any issue. Thank you so much for the support.

1 Like

I followed the Multiplexed paired-end FASTQ with barcodes in sequence protocol and it worked. Thank you so much for the support.

1 Like