Importing format with multiplexed fastq format, single read iwth barcode data in the reads, both forward and reverse directions

[hrv20]

I'm trying to import my data in a format that doesn't seem to be on the "importing data" guide.
My data is in a multiplexed fastq format, single read, with the barcode at the front of the sequence, not in a separate file. Furthermore, some of the reads are in the forward direction while others are in the reverse.

For example, an example read would be

m54120_171223_145018/4194963/ccs
GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACACTCAGTAGTTTACTACTGTTAAGGGGGCTGTTAGTCTGTATAGCTT
+m54120_171223_145018/4194963/ccs

Where the barcode is GGAAGTAAAA

Another example, but in the reverse direction would be


>m54120_171223_145018/4260252/ccs
GGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTAAAGAGTTGCAAAACTCCCTTCATACCATCGCGAACGTTACCCAATTCT
+m54120_171223_145018/4260252/ccs

Where the barcode is ACCCAATTCT, the reverse compliment of
AGAATTGGGT which is found at the end of the sequence

These are not actual data sets, just examples.
So if anyone knows what type of importing format I need to use, that would be much appreciated

[jairideout (Jai Ram Rideout)]

Hi @hrv20! We don’t have direct support for importing this data format, though there’s an open issue tracking progress on it. You might also check out this forum topic for some ideas from @Nicholas_Bokulich. We’ll follow up here when we have direct support for this data format in a QIIME 2 release!

In the meantime, you could try getting the reads into the same orientation such that every sequence begins with a barcode, and then import that data and demultiplex it following the q2-cutadapt Community Tutorial.