I’m trying to import my data in a format that doesn’t seem to be on the “importing data” guide.
My data is in a multiplexed fastq format, single read, with the barcode at the front of the sequence, not in a separate file. Furthermore, some of the reads are in the forward direction while others are in the reverse.
For example, an example read would be
m54120_171223_145018/4194963/ccs
GGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACACTCAGTAGTTTACTACTGTTAAGGGGGCTGTTAGTCTGTATAGCTT
+m54120_171223_145018/4194963/ccs
Where the barcode is GGAAGTAAAA
Another example, but in the reverse direction would be
>m54120_171223_145018/4260252/ccs
GGAAGTAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTAAAGAGTTGCAAAACTCCCTTCATACCATCGCGAACGTTACCCAATTCT
+m54120_171223_145018/4260252/ccs
Where the barcode is ACCCAATTCT, the reverse compliment of
AGAATTGGGT which is found at the end of the sequence
These are not actual data sets, just examples.
So if anyone knows what type of importing format I need to use, that would be much appreciated