Importing data in tutorial

Hi. I am new in Qiime and I am following tutorial tips. but in the first steps, I can't import the data. there is an error. do you know what should I do? firstly I make a directory and then change my directory to this new folder "qiime-tutorial....." , then I downloaded one .tsv file and 2 other files which named sequences and barcode. but there is an error in importing data. Please help me

Hi @mohsen_ej! Welcome!

The error message is letting you know that there are issues with the data file trying to import, in particular, there is a a record where the sequence length is not equal to the quality score length. Here is an example of what that might look like:

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%+

The most common cause of this is an incomplete file transfer or download. I suggest you delete the corrupt file and re-obtain (download, transfer, whatever). Let us know how it goes! :qiime2:

thank you for your attention.
I re-downloaded the file many times but it doesn't work still.

Hi @mohsen_ej!

You haven't shared an error message with us, so its not clear to me if the failure is the same, or something else entirely.

Can you tell us more about this data? Is it QIIME 2 tutorial data, or are you using your own data, following along with a tutorial?

Its Qiime tutorial data which is available on the website, moving pictures.
and error is the same.
Thank you for your attention. I think you are right the problem is about downloading the file but I don't know why because downloading is too easy :slight_smile:

Hi @mohsen_ej, sorry for the delay, I got sidetracked getting the 2020.8 release published this last week.

Maybe your next step should be to just start over cleanly - delete all of the files you have been working with so far and try again, carefully following each step, and observing any error messages or warning notes that might pop up.