Hello buys,
I have troubles importing my fan file. This is what I have done:
I have my fastq file (single) already trimmed, suppose file1.fq
I trasforma it to fasta file with seqkit fq2fa file1.fq -o file2.fna
I tried to import it in qiime2 with the command: qiime tools import --input-path file2.fna --output-path seqs.qza --type SampleData[Sequences]
I obtained the following error:
There was a problem importing prova.fna:
file2.fna is not a(n) QIIME1DemuxFormat file
Here is test file I am using:
(qiime2-2021.8) emastriani@bilbo-01:~/MetaVic/Clustering$ more file2.fna
SRR957824.2269 2269/1
ATATCAGTGAAAATGCCCTGAAGGTAATGTACAGGCTCAATAAAGCGGGATACGAAGCCTGGCTGGTTGGCGGCGGCGTGCGCGACCTGTTACTCGGCAAAAAGCCGAAAG
ATTTTGACGTAACCACTAACGCCACGCCTGAGCAGGTGC
SRR957824.2269 2269/2
ACTTCGATAATCTCCGGGCCAAACATCACATGAGCCAGACGGAAACGGCGACCCACCAGGCGGCAGTTACGGAACAGTTTGCGCACCTGCTCAGGCGTGGCGTTAGTGGTT
ACGTCAAAATCTTTCGGCTTTTTGCCGAGTAACAGGTCG
I am interested to import the fasta file because I need to practice with the procedure explained in Clustering sequences into OTUs using q2-vsearch
Thank you very much for your support.
Emilio
llenzi
(Luca)
November 11, 2021, 3:08pm
2
Hi @emiliomastriani ,
Did you download the sequences form sra?
This previous question may give you some help:
Hi there,
I am familiar with QIIME1 but relatively new with QIIME2. I have gotten my raw file in the past from a facility in the CASAVA pair ended demultiplexed format and I had no problem analyzing those files with both versions of qiime.
I am now conducting an investigation of public data available in the SRA archive and I am having a time importing the raw data as QIIME2 artifacts.
I have downloaded different projects (prefetch and fastq-dump commands in the SRA toolkit) and I don't think …
A general point, I would import the sequences fastq files, possibly as paired-end, if you have those (in your case you seems to have both R1 and R2 in the same file, so you need a script to split them into two files).
For the import, please have a look at the "Fastq manifest format" in the import guide:
Importing data — QIIME 2 2021.8.0 documentation
Then you would need to join your sequences as described at:
https://docs.qiime2.org/2021.8/tutorials/read-joining/
After that, you can use vsearch plug in to cluster your sequences as your initial point (starting form dereplicating the sample):
https://docs.qiime2.org/2021.8/tutorials/read-joining/
Hope it makes sense1
Cheers
Luca