Import problem: Not a(n) QIIME1DemuxFormat file

Hello buys,
I have troubles importing my fan file. This is what I have done:

  1. I have my fastq file (single) already trimmed, suppose file1.fq
  2. I trasforma it to fasta file with seqkit fq2fa file1.fq -o file2.fna
  3. I tried to import it in qiime2 with the command: qiime tools import --input-path file2.fna --output-path seqs.qza --type SampleData[Sequences]
  4. I obtained the following error:

There was a problem importing prova.fna:
file2.fna is not a(n) QIIME1DemuxFormat file

Here is test file I am using:
(qiime2-2021.8) emastriani@bilbo-01:~/MetaVic/Clustering$ more file2.fna

SRR957824.2269 2269/1
ATATCAGTGAAAATGCCCTGAAGGTAATGTACAGGCTCAATAAAGCGGGATACGAAGCCTGGCTGGTTGGCGGCGGCGTGCGCGACCTGTTACTCGGCAAAAAGCCGAAAG
ATTTTGACGTAACCACTAACGCCACGCCTGAGCAGGTGC
SRR957824.2269 2269/2
ACTTCGATAATCTCCGGGCCAAACATCACATGAGCCAGACGGAAACGGCGACCCACCAGGCGGCAGTTACGGAACAGTTTGCGCACCTGCTCAGGCGTGGCGTTAGTGGTT
ACGTCAAAATCTTTCGGCTTTTTGCCGAGTAACAGGTCG

I am interested to import the fasta file because I need to practice with the procedure explained in Clustering sequences into OTUs using q2-vsearch

Thank you very much for your support.
Emilio

Hi @emiliomastriani,

Did you download the sequences form sra?
This previous question may give you some help:

A general point, I would import the sequences fastq files, possibly as paired-end, if you have those (in your case you seems to have both R1 and R2 in the same file, so you need a script to split them into two files).

For the import, please have a look at the "Fastq manifest format" in the import guide:
Importing data — QIIME 2 2021.8.0 documentation

Then you would need to join your sequences as described at:
https://docs.qiime2.org/2021.8/tutorials/read-joining/

After that, you can use vsearch plug in to cluster your sequences as your initial point (starting form dereplicating the sample):
https://docs.qiime2.org/2021.8/tutorials/read-joining/

Hope it makes sense1
Cheers
Luca