Import Data- NovaSeq sequencing data. Error message in not recognizing forward.fastq.gz file

Hey team! I have run into a problem when importing my data. My sequencing data was sequenced at a sequencing facility on a Illumina NovaSeq. I renamed my fastq files from their given name of something like 'Pool1_X28947392_L1_1.fq' to 'forward.fastq.gz' and same for the reverse read. I also have my metadata.tsv file with the correct barcodes. Then when I ran the first command recommended in the import:

qiime tools import
--type MultiplexedPairedEndBarcodeInSequence
--input-path Pool_1
--output-path original_seqs.qza

I get an error reading:

'Missing one or more files for MultiplexedPairedEndBarcodesInSequenceDirFmt: 'forward.fastq.gz''

Is this error likely due to the formatting of the fastq file? It was originally a .fq file so I am not sure if this changes it. I was trying to figure out why others are getting this error as well and it keeps coming back to making sure the format is correct. I have checked the format:

The file looks something like this:

@A01415:38:H2FM3DRXY:1:2101:2483:1031 1:N:0:CTATGCCT+AAGAGGCA
ANTGATACGGCGACCACCGAGATCTACACGCTTGATATCGTCTTTATGGTAATTGTGTGTCAGCAGCCGCGGTAATACGGGGGGGACAAGTGTTATTCGGAATGACTGGGCGTAAAGAGTCTGTAGGCGGTTTTTTAAGTTGAATGCTAAAACTTGGATCTCAATTCCAAGAAGATGTTCAAAACTGATTAACTAGAGATTGAGAGGGGACAGTAGAATTTCTAATGGAGAGATAAAATTCATAGATATT
+
F#FFFFFFFFFFFFFF:FFFFFFFFFFFFFF:FFFF:FFFFFFFFF::FF,FF,FFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFF:FFF:,FFFFFFFFFFFFFFFFFFFFF,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FF:FFFFFFFFFFFFF:FFF,FFFFF:FF:FF,::FFFFFFF:FF:FFFFFFFFFFFFF:F:,FFFFFFFFFFFFFFFFFFFFFFF
@A01415:38:H2FM3DRXY:1:2101:9263:1031 1:N:0:CTATGCCT+AAGAGGCA
ANTGATACGGCGACCACCGAGATCTACACGCTGACTCAACCAGTTATGGTAATTGTGTGCCAGCAGCCGCGGTAAAACCAGCACCTCAAGTGGTCAGGATGATTATTGGGCCTAAAGCATCCGTAGCCGGCTCTGTAAGTTTTCGGTTAAATCTGTACGCTCAACGTACAGGCTGCCGGGAATACTGCAAAGCTAGGGAGTGGGAGAAGTAGACGGTACTCGGTAGGAAGTGGTAAAATGCTTTGATCTA
+
:#FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFF:::FFFF:FFFFFFF:FFFFFF,FFFFFFFFFFFFFFFFFFF:FFF,FFFF:FFFFFFF:,FFFFF,FFFFFF:FFFF:FFFFF:FFFF:FF,FFFF,FFFFF,FFFFFFFFFFF:FFFF,FFF,FFFFFF,FF,FFF:FFF:FFFF

There are 45ish samples in each Pool. So Pool 1 should have 45 different barcoded samples in it. The primer and the barcode is still in the sequence

For example the sequence in the first one is:

adaptor: ANTGATACGGCGACCACCGAGATCTACACGCT barcode: TGATATCGTCTT primer pad: TATGGTAATT primer linker: GT forward primer: GTGTCAGCAGCCGCGGTAA
sequence wanted: TACGGGGGGGACAAGTGTTATTCGGAATGACTGGGCGTAAAGAGTCTGTAGGCGGTTTTTTAAGTTGAATGCTAAAACTTGGATCTCAATTCCAAGAAGATGTTCAAAACTGATTAACTAGAGATTGAGAGGGGACAGTAGAATTTCTAATGGAGAGATAAAATTCATAGATATT

My primers are:

5′ Illumina adapter: AATGATACGGCGACCACCGAGATCTACACGCT
Golay barcode: XXXXXXXXXXXX
Forward primer pad: TATGGTAATT
Forward primer linker: GT
Forward primer (515F): GTGYCAGCMGCCGCGGTAA

Reverse complement of 3′ Illumina adapter: CAAGCAGAAGACGGCATACGAGAT
Reverse primer pad: AGTCAGCCAG
Reverse primer linker: CC
Reverse primer (806R): GGACTACNVGGGTWTCTAAT

I used the earth microbiome protocol but the sequencing center did not provide a barcode file and the barcodes are still in my fastq file so I need to import it differently from the EMP protocol on Qiime2. Any information or advice would help! Thanks

Hannah

Hello!
Could you try to remove ".gz" at the end of your files, so it would be 'forward.fastq', than use gzip command in the terminal to convert 'forward.fastq' to 'forward.fastq.gz'?
'.gz: at the end is an extension that gzip adds to compressed file.