I got an error importing my fastq files

Dear Experts

I am trying to import my fastq files generated using Miseq Illumina. My samples are demultiplexed and they are single end reads. I used this command:

qiime tools import
--type 'SampleData[SequencesWithQuality]'
--input-path manifest.txt
--output-path single-end-demux.qza
--input-format SingleEndFastqManifestPhred33V2

But I got this error:

This is my manifest file:

Sorry I am new in qiime so any help would be greatly appreciated.

Hi @ptalebic,
The issue seems to be in the delimiters of your manifest file. Looks like they were made as a comma-separated values file (.csv) thus the commas appearing in your table, but you need your manifest file to be in tab-separated values format. Retry remaking your manifest file as a true .tsv and then you should be good to go.

Dear Mehrbod,

Thank you so much. I created a tab-separated values file and it worked.

Best,
Pasha

Dear friends at Qiime2,

I am trying to import my paired end fastq files generated by a core facility (I am unsure of the format-Phred33 or Phred64).

Here are the first few lines of one of my fastq files:

@FCCHHFV:1:1101:8606:1291#TTC_TTGGAGGA_AGGCTTGT/1
GTGCAGCCGCCGCGGTAATACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTCTTAAGTCTGATGTAAAAGGCAGTGGCTCAACCATTGTGTGCATTGGAAACTGGGAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGTGTAGCGGTGAAATGCGTAGATATATGGAGGAACACCGGTGGCGAAAGCGGCTCTCTGGCCTGTAACTGACACTGAGGCTCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGT
+
CCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGCFGGGGGGGGGGGGGFGGGGGGGGGCCGGGGGGGGGFFFFGGGGGGGGGGGGGGGGFF,DCGCDGGFGGGGGGGGGGGGGGGDGCEGGDGGFGGFFCDGGFG:FGFGFGDFF=<FF??<BFFFFFFBF04<>?GFFF?>F5???BFF:?A?<<B<AFFFFFF<AAFF9?:9BF1
@FCCHHFV:1:1101:10196:1301#TTC_TTGGAGGA_AGGCTTGT/1

I made a tab delimited text manifest file for the seqs I want to import and used this command:

qiime tools import
--type 'SampleData[PairedEndSequencesWithQuality]'
--input-path manifest.txt
--output-path paired-end-demux.qza
--input-format PairedEndFastqManifestPhred64V2

But I got this error:

(qiime2-2019.10) qiime2@qiime2core2019-10:~/alison/16sdata/sequences$ qiime tools import \

--type 'SampleData[PairedEndSequencesWithQuality]'
--input-path manifest.txt
--output-path paired-end-demux.qza
--input-format PairedEndFastqManifestPhred64V2
There was a problem importing manifest.txt:

manifest.txt is not a(n) PairedEndFastqManifestPhred64V2 file:

Filepath on line 1 and column "forward-absolute-filepath" could not be found (/home/qiime2/alison/16sData/sequences/1_1.fq.gz) for sample "1".

I have uploaded my manifest file here. All of my sequence data is the specified path so I am unsure why it could not be found.

I am new to Qiime2 so I appreciate any feedback.

Thanks,
Alison

manifest.txt (658 Bytes)

Hi @ad2459,

Most new data should be in Phred33 format. Phred64 is an older system we rarely see these days.

The problem seems to be with the formatting in your manifest file. I'm not sure how this was made but it looks strange to me

wc manifest.txt 
  0  21 658 manifest.txt

Notice how it's showing 0 lines.

Have a look at the the manifest file used in the Parkinson Mouse tutorial for an example of what it should look like.

Hi @Mehrbod_Estaki,
I figured it out! Thank you!
I remade the manifest in google sheets and downloaded it as a .tsv.
But another problem was that my directory was bad.
I changed the path to include $PWD instead of the whole directory string that I was using before.

What a relief! Now I just have to figure out what to do next with my output file :slight_smile:

Thanks again,
Alison