how to make otus_rep.fasta file from OTU table

Hello,
I’m using Qiime2, I have otu table but I don’t know how to convert otu table to otu.fasta format. I like to see each otu’ sequence. After converting each otu should be like

denovo0 Sample.1_7124
CCTACGGGGGGCTGCAGCAGGG…

denovo1 Sample.1_123
CCTACGGGTGGCTGCAGTCGAG… etc

Best wishes,
Arne

Hi!
Did you check rep-seqs.qza file? Is it what you would like to have? You can import it

mkdir Rep-seqs
qiime tools export \
    --input-path rep_seqs.qza \
    --output-path Rep-seqs/

Thank you for your prompt answer. I did it and it worked.

output is

8c6f7847266182cf7900f8caad6a7679

CTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCG

dc15421d7cbfec2fee39a912aa3ed16f

CTACGGGTGGCTGCAGTAGGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCAATACCG

538b9520a3a4e869353b46121e6ab559

CTACGGGTGGCTGCAGTAGGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCAATACCG

My last question is; qiime created unique number for each OTU such as 8c6f7847266182cf7900f8caad6a7679 , it is possible to replace this code with sample name such as S1_123, S1_ 552… etc

best regards,

arne

The problem is that it is a name of the feature (sequence), that can be presented in several or all of your samples. So, for example, the same sequence will be named in your dataset S1_123 and S2_125, and will be treated as different features (sequences).

Can you tel me how can I do that?

What is the goal of renaming OTUs or ASVs? It can broke the workflow oof the analysis and cause errors. At which stage you want to rename sequences?

We submitted an article about metagenome and journal editor is asking fasta file of the otu table. Editor also asks to indicate sample name in each otu.
once again thank you for your help

best wishes

arne

It is a little bit strange, in my opinion, unless I am missing something.
As far as I know, there is no way in Qiime2 to rename the OTU/ASV IDs by adding sample names to it. Of course, if all analysis already performed, and all you need is to provide such fasta file, you can add sample name before sequence ID, like S1_8c6f7847266182cf7900f8caad6a7679. But I don’t know how to deal with it, if you have the same ASV or OTU in several samples.
It will also require some coding in a suitable language, if you know some of them.
Maybe it is easier to decline this request with proper explanation and provide a fasta files as it is, unless it is very important (I don’t know specific aspects of your manuscript)

I’m sorry to disrupt you but last question.
Is it possible to blast dna-seqs.fasta generated from rep_seqs.qza in qiime2 to form otu table?
best wishes
arne

Hi @arne, sorry for the slow reply. Can you explain in a little more detail what you’re looking for here?

This topic was automatically closed 31 days after the last reply. New replies are no longer allowed.